ID: 953475655

View in Genome Browser
Species Human (GRCh38)
Location 3:43203717-43203739
Sequence TTTCTCTTACAGCTTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953475655_953475660 -6 Left 953475655 3:43203717-43203739 CCCTGCCCAAGCTGTAAGAGAAA No data
Right 953475660 3:43203734-43203756 GAGAAACAAGGCTGAACAAGAGG No data
953475655_953475661 8 Left 953475655 3:43203717-43203739 CCCTGCCCAAGCTGTAAGAGAAA No data
Right 953475661 3:43203748-43203770 AACAAGAGGCTCAAGAGAAGTGG No data
953475655_953475663 17 Left 953475655 3:43203717-43203739 CCCTGCCCAAGCTGTAAGAGAAA No data
Right 953475663 3:43203757-43203779 CTCAAGAGAAGTGGCATGAAGGG No data
953475655_953475662 16 Left 953475655 3:43203717-43203739 CCCTGCCCAAGCTGTAAGAGAAA No data
Right 953475662 3:43203756-43203778 GCTCAAGAGAAGTGGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953475655 Original CRISPR TTTCTCTTACAGCTTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr