ID: 953477518

View in Genome Browser
Species Human (GRCh38)
Location 3:43218229-43218251
Sequence CAATAACCCCAGATAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953477518_953477519 10 Left 953477518 3:43218229-43218251 CCATGCTCTATCTGGGGTTATTG No data
Right 953477519 3:43218262-43218284 GTTTTTCTTTACTTTTCATCAGG No data
953477518_953477520 21 Left 953477518 3:43218229-43218251 CCATGCTCTATCTGGGGTTATTG No data
Right 953477520 3:43218273-43218295 CTTTTCATCAGGCCAGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953477518 Original CRISPR CAATAACCCCAGATAGAGCA TGG (reversed) Intergenic
No off target data available for this crispr