ID: 953481038

View in Genome Browser
Species Human (GRCh38)
Location 3:43252470-43252492
Sequence GACCTGGGTGGTGATTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953481038_953481047 24 Left 953481038 3:43252470-43252492 CCTGTATAATCACCACCCAGGTC No data
Right 953481047 3:43252517-43252539 CTCCTTCTGCCTCGTCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953481038 Original CRISPR GACCTGGGTGGTGATTATAC AGG (reversed) Intergenic
No off target data available for this crispr