ID: 953481615

View in Genome Browser
Species Human (GRCh38)
Location 3:43256956-43256978
Sequence GTGGCCTTGCTGACCTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953481615_953481621 24 Left 953481615 3:43256956-43256978 CCTGAAGAGGTCAGCAAGGCCAC No data
Right 953481621 3:43257003-43257025 CAGCTCCAGGAGGAGAGAAATGG No data
953481615_953481620 14 Left 953481615 3:43256956-43256978 CCTGAAGAGGTCAGCAAGGCCAC No data
Right 953481620 3:43256993-43257015 CAGCGTTAAGCAGCTCCAGGAGG No data
953481615_953481619 11 Left 953481615 3:43256956-43256978 CCTGAAGAGGTCAGCAAGGCCAC No data
Right 953481619 3:43256990-43257012 GCTCAGCGTTAAGCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953481615 Original CRISPR GTGGCCTTGCTGACCTCTTC AGG (reversed) Intergenic
No off target data available for this crispr