ID: 953482159

View in Genome Browser
Species Human (GRCh38)
Location 3:43261084-43261106
Sequence TGAAAGTGGGTTGTTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953482159_953482163 18 Left 953482159 3:43261084-43261106 CCTGTTTCAACAACCCACTTTCA No data
Right 953482163 3:43261125-43261147 CAGTGTTACCTCTACTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953482159 Original CRISPR TGAAAGTGGGTTGTTGAAAC AGG (reversed) Intergenic
No off target data available for this crispr