ID: 953482160

View in Genome Browser
Species Human (GRCh38)
Location 3:43261097-43261119
Sequence ACTTATTACTTAATGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953482160_953482163 5 Left 953482160 3:43261097-43261119 CCCACTTTCATTAAGTAATAAGT No data
Right 953482163 3:43261125-43261147 CAGTGTTACCTCTACTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953482160 Original CRISPR ACTTATTACTTAATGAAAGT GGG (reversed) Intergenic
No off target data available for this crispr