ID: 953482161

View in Genome Browser
Species Human (GRCh38)
Location 3:43261098-43261120
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953482161_953482163 4 Left 953482161 3:43261098-43261120 CCACTTTCATTAAGTAATAAGTA No data
Right 953482163 3:43261125-43261147 CAGTGTTACCTCTACTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953482161 Original CRISPR TACTTATTACTTAATGAAAG TGG (reversed) Intergenic
No off target data available for this crispr