ID: 953499773

View in Genome Browser
Species Human (GRCh38)
Location 3:43421979-43422001
Sequence TGCAGGTAAATGCCTAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953499773_953499776 14 Left 953499773 3:43421979-43422001 CCAATCCTAGGCATTTACCTGCA 0: 1
1: 0
2: 0
3: 18
4: 146
Right 953499776 3:43422016-43422038 CTCCCATATGTTGACCATCATGG 0: 1
1: 0
2: 1
3: 3
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953499773 Original CRISPR TGCAGGTAAATGCCTAGGAT TGG (reversed) Intronic
901126477 1:6932520-6932542 CTCGGGTAAATGCCTAGGAGTGG + Intronic
901948082 1:12719612-12719634 TGCAGGTGGATGCCTTGGGTTGG - Exonic
902094467 1:13931262-13931284 TCCAGGTACATGGCTATGATTGG + Intergenic
902913533 1:19620644-19620666 TGCAGATAAATGCCTATAATAGG + Intronic
904134777 1:28303437-28303459 TTCAGGTGTATGCCTAGGAATGG + Intergenic
904534140 1:31188114-31188136 TGCAGGAAGTTGGCTAGGATGGG + Exonic
906313013 1:44767288-44767310 TTCTGGTAAATGCCAAGTATGGG + Exonic
911233748 1:95387373-95387395 TGCACATACATGCCTAGGGTAGG + Intergenic
912364224 1:109119820-109119842 TGAAGGTATAAGCCTAGGAGTGG + Intronic
912524314 1:110269645-110269667 TCCTGGTAAATACCTAGGAACGG + Intronic
913108831 1:115640414-115640436 TTCAGGTACATGACTAGAATTGG + Intergenic
917989724 1:180361686-180361708 TGCAGATAAATGCCTATAATGGG + Intronic
919329506 1:196152227-196152249 TGCAGGTTAGAGCCCAGGATTGG + Intergenic
920851706 1:209632565-209632587 TGCAGGTAACAGCCTAGGGTGGG - Exonic
923047734 1:230367892-230367914 TGCAGGTGAATGCAGAGGCTCGG + Intronic
924161813 1:241240791-241240813 TATAGGTAAACGGCTAGGATCGG + Intronic
1068197553 10:53737219-53737241 TGTCTGTAAATGCCTAGGAATGG - Intergenic
1068639453 10:59386896-59386918 TGCAGGTAAATACCAAGGTTAGG - Intergenic
1073044425 10:100628482-100628504 GGCAGGTCAGTGCCTAGGCTGGG + Intergenic
1073642129 10:105263500-105263522 AGCAGGCAAATGCCTAGCTTTGG + Exonic
1075580611 10:123615175-123615197 TGCAGGTAACTGTCTTGAATGGG + Intergenic
1077149972 11:1068131-1068153 GCCAGGTAAATACCTAGGAGTGG - Intergenic
1078868938 11:15326205-15326227 TGCATGTAAATGCTTAAGATTGG - Intergenic
1083610963 11:64004104-64004126 AGCAGGGAGATGCCTAAGATGGG - Intronic
1084765258 11:71304155-71304177 AGGAGGTAAATGCCTATGGTTGG - Intergenic
1085487341 11:76876557-76876579 CATAGGTAAATGCTTAGGATTGG + Intronic
1086045837 11:82530344-82530366 TGCAACTAAATGCTTAGGATTGG + Intergenic
1088741482 11:112770899-112770921 TGTGGGTATATGCCTAGGAGTGG - Intergenic
1088841458 11:113630700-113630722 TCTAGGTAAAGCCCTAGGATGGG + Intergenic
1091193252 11:133711760-133711782 TGGAGGAACATGCCTAGGAATGG - Intergenic
1092956005 12:13550718-13550740 TGCATTTTAATGACTAGGATGGG - Exonic
1095321421 12:40832904-40832926 AGCAGGTAAGTGCTTAGGATTGG - Intronic
1095735637 12:45553542-45553564 TGCAGCCAAATGCCCATGATAGG - Intergenic
1096003596 12:48149981-48150003 TACAGGTGAATGCCCTGGATGGG - Exonic
1096910953 12:54983521-54983543 TGCAGGGCAGTACCTAGGATGGG - Intronic
1097308439 12:58093887-58093909 TGCAGCAAAATGCCTAGACTGGG - Intergenic
1097776745 12:63655898-63655920 AGTCGGTAAATGCCTAGTATGGG - Intronic
1097799387 12:63896469-63896491 GGCAAATAAATGCCTAGGAGAGG + Intronic
1098393438 12:69993463-69993485 TTCAGGTAAATTCCTAGGAGTGG + Intergenic
1099623308 12:85032193-85032215 TGCAGATAAATGGGTAGCATAGG + Intronic
1100438755 12:94596122-94596144 TGCTGGAAAATGACTAGGATAGG - Intronic
1101042592 12:100771781-100771803 TGCATGAAGATGCCTAGGCTAGG + Intronic
1104124090 12:125828691-125828713 TGTAGGTAAATACCTAGGAATGG - Intergenic
1104941473 12:132397454-132397476 TGCAGGTGAAAGCCCAGGAGGGG - Intergenic
1104941507 12:132397572-132397594 TGCAGGTGAAAGCCCAGGAGGGG - Intergenic
1105427167 13:20303774-20303796 TGCAGGCAAATGACTACTATGGG - Intergenic
1107330278 13:39292293-39292315 TTCAGGTATATGCCTAGTAATGG - Intergenic
1110379685 13:74836075-74836097 TGGAGGTAAAGGTCCAGGATGGG - Intergenic
1112527590 13:100166770-100166792 TTTTGGTAAATGCCTAGGAGTGG + Intronic
1112776531 13:102849881-102849903 TGCAGGTAAATTTCTAACATAGG - Intronic
1114931674 14:27476822-27476844 TGCAGGTATATACCTAGAAGTGG + Intergenic
1115586385 14:34817977-34817999 TGCGGGTATATGCCTAGAAGTGG - Intronic
1116689955 14:48093102-48093124 CTAAGGTAAATACCTAGGATTGG + Intergenic
1117893964 14:60459381-60459403 TCTAGGTATATACCTAGGATCGG + Intronic
1122024499 14:98865742-98865764 TTTAGGTAAATACCTAGGAATGG - Intergenic
1126731489 15:51687798-51687820 TGCAGGCAAATTCCTGGGGTAGG - Intronic
1128366830 15:67010271-67010293 TACATATAAATTCCTAGGATGGG + Intergenic
1131743940 15:95424446-95424468 TGGAGGAAATTGACTAGGATGGG - Intergenic
1131798802 15:96048367-96048389 TGCAGGTTCATGTCTAGAATTGG + Intergenic
1133982137 16:10640978-10641000 TTTGGGTAAATGCCTAGGAGTGG + Intronic
1140608223 16:76566557-76566579 CTTAGGTAAATGCCTAGAATTGG + Intronic
1144256096 17:13470241-13470263 TGGAGGAAAATGCCAAGAATAGG + Intergenic
1148663110 17:49352622-49352644 TGTGGGTAAATACCTAGGAGGGG - Intronic
1150380288 17:64714740-64714762 TCCAAGTAAATGCTTAGGAAAGG + Intergenic
1151473558 17:74332558-74332580 AGCAGGTAAATGCTAATGATGGG - Intronic
1158986633 18:62824224-62824246 CTCGGGTAAATACCTAGGATTGG - Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1163250377 19:16123155-16123177 AGCAGGTAAATGGCTAGGCTGGG + Intronic
926963143 2:18380727-18380749 TGCAGGTAAAAGCCAAACATAGG + Intergenic
927206250 2:20612815-20612837 TTTAGGTATATGCCTAGGAGTGG + Intronic
929810159 2:45182946-45182968 TGCAGGAAAGTGCCAAGGAAAGG + Intergenic
930613596 2:53570585-53570607 CATAGGTAAATACCTAGGATTGG + Intronic
931117177 2:59177528-59177550 TGCAGGGAAATATCTAAGATTGG - Intergenic
931510636 2:62988878-62988900 TGCAGGTGCATGCCATGGATAGG - Intronic
931771214 2:65499795-65499817 TGCAGAAAAATGCCTAGAGTAGG + Intergenic
932054485 2:68430887-68430909 TGCAGGTAGATGACTAGGTTAGG + Intergenic
933677631 2:85071012-85071034 TTCAGGTAAATGCCCAGGAACGG + Intergenic
934672752 2:96225855-96225877 TTCAGGTAAATACCTAGAAAAGG + Intergenic
934724112 2:96604146-96604168 TGGAGCTAAATCCATAGGATGGG - Intronic
938828376 2:135029703-135029725 TGAAGGTAAATGCCAAGAGTAGG + Intronic
940773721 2:157865441-157865463 TGGAGATAAATACCAAGGATTGG - Intronic
942351956 2:175062117-175062139 TTTGGGTAAATACCTAGGATTGG - Intergenic
944730459 2:202511412-202511434 TTCTGATATATGCCTAGGATTGG + Intronic
947589572 2:231377847-231377869 TGCAGGAAAATCCTTAGGAAAGG - Intergenic
948979264 2:241484713-241484735 TGTAGGCACATGCCTGGGATGGG + Intronic
1170143004 20:13143712-13143734 TGCAGGCAGCTGCCTTGGATGGG + Intronic
1175073702 20:56356227-56356249 TGCAGGCAAATTCCTATGAACGG - Intergenic
1175566291 20:59979965-59979987 TGTAGGTAGATACCTAGGAGTGG + Intronic
1177003678 21:15644786-15644808 TGCAGCTAAATTTCTAGCATAGG + Intergenic
1178112449 21:29382296-29382318 AGCAGGTGAATGACTATGATGGG - Intronic
1178934697 21:36851168-36851190 TTTGGGTATATGCCTAGGATTGG - Intronic
1184062841 22:42094928-42094950 TCAGGGTAAATACCTAGGATTGG - Intergenic
1184416215 22:44353174-44353196 TGCAGGTAAATTCCTGGTTTTGG + Intergenic
950957524 3:17070454-17070476 TGGAAGTAAATGTATAGGATGGG + Intronic
951263926 3:20545512-20545534 TGAAGGTAAATTCCTAGAAGTGG + Intergenic
952901745 3:38115687-38115709 TGCAGGCAGATGTCTAGGTTTGG + Intronic
953499773 3:43421979-43422001 TGCAGGTAAATGCCTAGGATTGG - Intronic
953585496 3:44197076-44197098 TGCAGTTAAATGCCATGAATAGG + Intergenic
955242394 3:57189976-57189998 TGAAGGTAAATACCTAGAAGTGG + Intergenic
957272284 3:78046783-78046805 TGAAAGTAAATCCCTAGGAATGG + Intergenic
959175621 3:102905648-102905670 CTCAGGTAAATACCTAGGAATGG + Intergenic
965788031 3:172356855-172356877 CGCAGGTAAAGGGCTAGGGTAGG - Intronic
966707417 3:182931668-182931690 TTTAGGTATATGCCTAGGATTGG - Intergenic
972546286 4:40083607-40083629 TTCATATAAATGCCTAGAATAGG + Intronic
975125029 4:70772388-70772410 TGAAGCTAACTGCCTAGGTTTGG + Intronic
981890986 4:149736827-149736849 CTCTGGTAAATACCTAGGATTGG - Intergenic
982394968 4:154906519-154906541 TCCAGGTATATACCTAGGAGTGG + Intergenic
982577331 4:157130751-157130773 TGGGGGTATATACCTAGGATTGG + Intronic
983439823 4:167767321-167767343 TGTAGCTAAATTCCTAGGAGTGG + Intergenic
983539224 4:168890667-168890689 GGTAGGTAGATGCCAAGGATGGG - Intronic
986852853 5:11833126-11833148 CTCACGTAAATGCCTAGGAATGG - Intronic
987247045 5:16059701-16059723 TGCAGGTAAGTGCATAGCTTTGG - Intergenic
988051055 5:26031596-26031618 TGCAGGGAGATGCCGAGGGTTGG - Intergenic
988913896 5:35873444-35873466 TGCAGTTACATTCTTAGGATGGG - Intronic
989508009 5:42249826-42249848 TGAAGGTAAATGCCTAGACATGG - Intergenic
991285312 5:64968372-64968394 TGGGGGTAAATACCTAGGAGTGG - Intronic
992521627 5:77557680-77557702 TGTAGGTACGTGCCTAGGAGTGG - Intronic
994313802 5:98308542-98308564 TGGAGGAAAATGCCTGGGAAAGG - Intergenic
997748620 5:136322361-136322383 TTAGGGTAAATGCCTAGGAGCGG + Intronic
1000489188 5:161887932-161887954 TGGAGGTAAATACCTTGCATAGG - Intronic
1000716692 5:164653163-164653185 TGTAGGTAAATTCCTAGGAGTGG + Intergenic
1002780189 6:359382-359404 TGCAGGTAAAGGCCCAGAACTGG + Intergenic
1008176498 6:48273983-48274005 TGCAGGTATGTACCTAGGAAGGG + Intergenic
1009287698 6:61842708-61842730 TCTAGGTATATGCCTAGGAGTGG - Intronic
1015559688 6:134501529-134501551 AGAAGGTGAATGCCTAGAATTGG - Intergenic
1015888814 6:137948449-137948471 TGCAGGGGAAGGTCTAGGATGGG - Intergenic
1016203308 6:141440386-141440408 CTTGGGTAAATGCCTAGGATTGG + Intergenic
1016753682 6:147660378-147660400 TGCAGGGCAAGGCCTAGGAAAGG - Intronic
1019026915 6:168974059-168974081 TGCAGTGAAAGGCCTAGGATTGG - Intergenic
1021531767 7:21654587-21654609 TGTAGGTATATACCTAGGAGAGG + Intronic
1022034356 7:26519540-26519562 TGCACGTAATTGCCAAGCATAGG - Intergenic
1022699712 7:32747843-32747865 AGTCGGTAAATGCCTAGTATGGG - Intergenic
1024284538 7:47745805-47745827 TTAAGGTAAATGCCTAGTAGTGG + Intronic
1025924946 7:65950816-65950838 TGCATGTAAATGCATAGAAAAGG + Intronic
1025974646 7:66359917-66359939 AGAAGGGAAATTCCTAGGATTGG + Exonic
1026513727 7:71049257-71049279 TGCAGGGAACTGCCTGGCATGGG - Intergenic
1028654147 7:93183692-93183714 GCCAGGTAAATTCCCAGGATTGG - Intergenic
1028851035 7:95537780-95537802 TCCACTTAAATACCTAGGATTGG - Exonic
1029163996 7:98573192-98573214 CTCAGGTAAATACCTAGGAGTGG + Intergenic
1029917197 7:104223210-104223232 AGATGGTAAATGCCTTGGATGGG - Intergenic
1030104026 7:105971526-105971548 TGGAGTCAGATGCCTAGGATTGG + Intronic
1031664647 7:124469045-124469067 TTTAGGTAAATACCTAGGAGTGG + Intergenic
1032645582 7:133820326-133820348 TGCAGGAAAATACCAAAGATAGG - Intronic
1035011819 7:155725063-155725085 TGTCAGTAAATGCCTAGGAGTGG + Intronic
1035544998 8:473499-473521 TTCACGTGAATGCCTAGGAGAGG + Intergenic
1036616772 8:10393867-10393889 TGCATGTACATGCATAGGGTTGG + Intronic
1042441229 8:68829020-68829042 TGCATGTAAGTGCCTTGGCTTGG + Intergenic
1044133402 8:88555370-88555392 TGTGGGTATATACCTAGGATTGG + Intergenic
1045542032 8:103095704-103095726 TGTATGTAAATGCCTAGGAAAGG + Intergenic
1045795749 8:106041635-106041657 CTCGGGTAAATGCCTAGGAGTGG + Intergenic
1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG + Intronic
1049376095 8:142289908-142289930 TGCAGGCAGATCCCAAGGATGGG + Intronic
1050674280 9:8034392-8034414 TGAAGTGAAGTGCCTAGGATGGG - Intergenic
1051343835 9:16134797-16134819 TTTAGGTAAATACCTAGGAGTGG - Intergenic
1055601291 9:77921626-77921648 TGCAGGGAAATGCGTTGGAAAGG + Intronic
1056458670 9:86788208-86788230 AGCAGGAAAATGGCTAGCATGGG - Intergenic
1056535353 9:87522637-87522659 TGTAGGTAAATTCCTAGAAGTGG + Intronic
1057333394 9:94137661-94137683 TTTGGGTAAATGCCTAGGAGTGG - Intergenic
1059736166 9:117102019-117102041 TGGAGGTATATACCTAGGAGTGG - Intronic
1060672377 9:125481121-125481143 TGCAGGTAAGTGGCAAGGCTGGG + Intronic
1185625448 X:1478179-1478201 TACAGAGAAATGCTTAGGATTGG - Intronic
1189870500 X:45377672-45377694 TTCGGGTATATACCTAGGATTGG - Intergenic
1193344878 X:80394058-80394080 TTCAGGTAAATGCCTAGAAGAGG + Intronic
1197383609 X:125776156-125776178 TCCTGGTAAATGCAAAGGATGGG + Intergenic
1202199939 Y:22335855-22335877 AGCAGGTAAATGCCTGGTAGAGG + Intronic