ID: 953500603

View in Genome Browser
Species Human (GRCh38)
Location 3:43429801-43429823
Sequence TAAATTCCTCAATAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953500603_953500606 27 Left 953500603 3:43429801-43429823 CCATTCTCCTATTGAGGAATTTA 0: 1
1: 0
2: 1
3: 22
4: 317
Right 953500606 3:43429851-43429873 ATGTTTCAATGACTAAATTTTGG 0: 1
1: 0
2: 2
3: 48
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953500603 Original CRISPR TAAATTCCTCAATAGGAGAA TGG (reversed) Intronic
900703939 1:4064109-4064131 TCAGTTCCTCAAGAGGAGGATGG + Intergenic
901017582 1:6240955-6240977 TAAATTCCCCAACATGAGACAGG + Intergenic
901342795 1:8510443-8510465 TCATTTCTTCATTAGGAGAATGG + Intronic
901369599 1:8785530-8785552 GAAATTCCTCTGTTGGAGAATGG - Intronic
902827170 1:18984052-18984074 TATATCCATCAAGAGGAGAATGG + Intergenic
905195471 1:36273416-36273438 GAATTTCCTCAATATGATAAAGG + Intronic
906863379 1:49387721-49387743 TAAATGCATCAATATCAGAAAGG - Intronic
907112467 1:51938457-51938479 TATATTCAACAATAGGAGAATGG + Intronic
908023556 1:59923672-59923694 AAAATAGCTCAATAGCAGAATGG + Intronic
910553808 1:88507404-88507426 CAAATTCCTCATTAGTAAAATGG - Intergenic
910717272 1:90245732-90245754 TAAATCCATCAATGGTAGAATGG + Intergenic
911331019 1:96525896-96525918 TAATTTCCTGAGTAGGAGCATGG - Intergenic
912089163 1:106049316-106049338 TAAAGTCCCCTATAAGAGAAAGG - Intergenic
913399800 1:118418784-118418806 TATATTCATCAAGAGTAGAATGG + Intergenic
915114245 1:153585711-153585733 TAAAATCCTCAAAAAGATAAAGG + Intergenic
915122747 1:153641343-153641365 TAAATTCCTTCAAAGGAAAAAGG - Intronic
915563633 1:156701805-156701827 TAGATTCCTCAATTGTAAAATGG + Intronic
918115874 1:181497064-181497086 TAAATACCTCTCTATGAGAAGGG - Intronic
919563703 1:199157416-199157438 TCAAATCCTGAAAAGGAGAAGGG + Intergenic
921860379 1:220036966-220036988 TAAAAACCTCAATAGAAAAATGG + Intronic
924408776 1:243781468-243781490 TAAATGACCCAATAGAAGAAAGG - Intronic
1063397599 10:5705377-5705399 AATATTCATCAATAGGTGAATGG - Intronic
1063402529 10:5760429-5760451 TAAATTCCACAAAAGGTCAAAGG - Intronic
1064604146 10:17021185-17021207 TAAATACCTCAATGGAAAAATGG - Intronic
1064833513 10:19498910-19498932 TAAATTCCCTAATTGGAGGAGGG + Intronic
1065452882 10:25877139-25877161 TAAATTCCTCAACTGTAAAATGG + Intergenic
1066528210 10:36305831-36305853 TCAGTTCTTCAATAGGAAAAAGG - Intergenic
1068118227 10:52758176-52758198 AAATTTCATGAATAGGAGAAAGG - Intergenic
1068713349 10:60157680-60157702 TCAGTTTCTCAATAGCAGAATGG + Intronic
1068975977 10:63009980-63010002 TTAATTCCTCAAAAGGAAATGGG - Intergenic
1069331998 10:67303766-67303788 TAAATATCTAAATAGGGGAAAGG - Intronic
1070212713 10:74343128-74343150 TAACTTCCTCAATCTGATAAAGG - Intronic
1070432526 10:76355414-76355436 TAATTTGTTCAATATGAGAATGG + Intronic
1071073248 10:81719869-81719891 GAACTTCCTCAACAGGATAAAGG + Intergenic
1071386154 10:85123500-85123522 TATATACCTCAGAAGGAGAAAGG + Intergenic
1073790877 10:106939065-106939087 TAGATTCCTAATTGGGAGAAGGG + Intronic
1073931488 10:108582025-108582047 TAAATACCTTCAAAGGAGAAGGG + Intergenic
1074610755 10:115018750-115018772 CACATTTCTCAATTGGAGAAGGG + Intergenic
1075217574 10:120551476-120551498 AAAGTTAATCAATAGGAGAATGG + Intronic
1075855908 10:125630256-125630278 TGAATTCCTGACTCGGAGAATGG - Intronic
1076362329 10:129897903-129897925 GAAATTCCTCACCAGGAAAAGGG - Intronic
1076812450 10:132895299-132895321 AAAATTCCTCAACATGATAAAGG + Intronic
1077799761 11:5525912-5525934 AAAATTCCTCAATGGAAAAATGG - Intronic
1078038035 11:7828478-7828500 TTAATTGCTGAATAGCAGAAGGG + Intergenic
1078039633 11:7847886-7847908 TGAAATTATCAATAGGAGAAAGG - Intergenic
1078885468 11:15495709-15495731 TGAATTGCTCAAGAGGTGAAAGG + Intergenic
1081004165 11:37713126-37713148 TGAATTAATCACTAGGAGAATGG + Intergenic
1081199842 11:40202588-40202610 TAATTTCCCGAATAGGGGAAGGG + Intronic
1082926674 11:58554718-58554740 AAAATTCCTAAGTGGGAGAATGG + Intronic
1085181428 11:74540167-74540189 TAAATGCCCCAGTAGGAGACCGG + Intronic
1085734641 11:79028742-79028764 TATAATCCTGAATAGCAGAAGGG + Intronic
1086145476 11:83546423-83546445 GAATTTCCTAAATAAGAGAATGG - Intronic
1086752196 11:90511101-90511123 TGAATTCCATAATAGAAGAAGGG - Intergenic
1086999924 11:93407219-93407241 TGAATTCAACAATAGAAGAATGG + Intronic
1087571976 11:99940062-99940084 TAATTTCTTTAATAGGAGCAGGG + Intronic
1087734092 11:101811903-101811925 GTAATTCCTCAAGAGGAAAAAGG - Intronic
1087952023 11:104233011-104233033 AAACTTCCTCAATCGGATAAAGG - Intergenic
1088208338 11:107421959-107421981 CAAATTCACCAACAGGAGAATGG + Intronic
1089239118 11:117060100-117060122 CAAGTTCCTTAATAGGTGAATGG + Intronic
1089766274 11:120768690-120768712 AAAATTCCTCAATACAATAAAGG - Intronic
1092798699 12:12141013-12141035 TAAATTCCTTAATTTGACAAAGG + Intronic
1092798846 12:12142807-12142829 TAAATTCCTTAATTTGACAAAGG + Intronic
1093387055 12:18569900-18569922 TAAATTATTCAATAGAAAAATGG - Intronic
1093687568 12:22074179-22074201 TAAATAGCTCAAAAGGAAAAAGG + Intronic
1093800908 12:23371976-23371998 CAAATTCATCAAAAGGATAATGG - Intergenic
1094192979 12:27715513-27715535 TAGATTCCTCCATAGAAGTAAGG - Intronic
1095523460 12:43096124-43096146 TAGATTCCTAATTAGGTGAACGG + Intergenic
1097591555 12:61581595-61581617 TACATTCTTCAAAGGGAGAAAGG + Intergenic
1097947636 12:65389505-65389527 TAAAATCCTCAATAAATGAAGGG - Intronic
1099642457 12:85309521-85309543 GAGATTCGTCATTAGGAGAATGG + Intergenic
1100136621 12:91560544-91560566 GAAAATCCTCAATAAAAGAATGG + Intergenic
1100209592 12:92387760-92387782 CAAATTCTTCAATGGGAAAAAGG + Intergenic
1100467963 12:94864809-94864831 TAAATACATCAATAGAATAAAGG + Intergenic
1101121785 12:101589040-101589062 TAACTTCCTCAACATGATAAAGG + Intronic
1101503620 12:105327144-105327166 AAAATTCCTAAAAAGGAAAAAGG + Intronic
1103010321 12:117453606-117453628 AAAATTCCTCAATTGTAAAAAGG - Exonic
1103255995 12:119541906-119541928 TAAATGACTGAATAGGTGAATGG - Intergenic
1104295888 12:127513133-127513155 TAAATTTATCATCAGGAGAAAGG + Intergenic
1105652457 13:22394113-22394135 TGAATTGCTCAATAGAAAAAAGG + Intergenic
1106040579 13:26086905-26086927 TAAATTCCTGAAAATAAGAAAGG + Intergenic
1107185407 13:37513102-37513124 TAATTTCCTCATTAGTAAAATGG + Intergenic
1107326378 13:39247722-39247744 CAAATTCTTCAATAGATGAATGG + Intergenic
1107332698 13:39319045-39319067 TAAATGGCCTAATAGGAGAAGGG + Intergenic
1107412570 13:40171832-40171854 TCAAATGCTCAATAGGAAAATGG - Intergenic
1107741786 13:43458248-43458270 TAAACTCCCCGATAGGAAAATGG + Intronic
1107992164 13:45828229-45828251 TCAAATACTCAAGAGGAGAAGGG - Intronic
1108329469 13:49370834-49370856 TATATTCCTTTATAGGATAAAGG + Intronic
1108981866 13:56524057-56524079 TGAATTCCTCCATAGAAAAATGG + Intergenic
1110676357 13:78250720-78250742 TCAATTCCTCCATAGGAAGAAGG + Intergenic
1110717746 13:78726817-78726839 AAAATTCCTCAATCTGACAAGGG + Intergenic
1110972080 13:81776401-81776423 GATGTTCCTCAATAGGTGAAAGG - Intergenic
1111036986 13:82688498-82688520 TATAATCCTCAATTTGAGAAGGG + Intergenic
1111921214 13:94413129-94413151 AAAATTGCTGAAAAGGAGAAGGG - Intergenic
1116853200 14:49928864-49928886 TAAATTCCCCCTGAGGAGAAAGG - Intergenic
1117236153 14:53778353-53778375 AATTTTCCTCAATAGGTGAATGG + Intergenic
1117790984 14:59342023-59342045 TAATTCCCTCAATAACAGAATGG - Intronic
1120432356 14:84435276-84435298 TCCATTTCTCAATAGGAGCAGGG - Intergenic
1121480173 14:94261713-94261735 TAACTTCCTCAATCTGATAAAGG - Intronic
1121712446 14:96048888-96048910 GAAGTTCTTCAATAGGTGAATGG - Intronic
1123492554 15:20793865-20793887 TACATTCCAAAATGGGAGAAAGG + Intergenic
1123686656 15:22802932-22802954 AAAGTTCATCAACAGGAGAATGG - Intronic
1124185913 15:27529161-27529183 TAATTTCCTCATTTGTAGAAAGG - Intronic
1124427634 15:29575348-29575370 TAACTTCCTCAACACGATAAAGG + Intergenic
1124429880 15:29597671-29597693 TATATCCTTCAATAGGTGAATGG - Intergenic
1126275658 15:46876727-46876749 GAAATTCCTCAACCAGAGAAGGG + Intergenic
1127197589 15:56606318-56606340 GAACTTCCTCAACATGAGAAAGG - Intergenic
1130787202 15:87113344-87113366 GACATTCTTCAATAGGTGAATGG + Intergenic
1130793691 15:87185648-87185670 AAACTTCCTCAATATGATAATGG + Intergenic
1131611259 15:93966688-93966710 TATATTCTTCAATAGGTGAATGG - Intergenic
1202957389 15_KI270727v1_random:90178-90200 TACATTCCAAAATGGGAGAAAGG + Intergenic
1133512212 16:6471034-6471056 TTAATTCCTCTATAAGAAAATGG - Intronic
1133892052 16:9888777-9888799 TAAATTCCTCAATCTGATAAAGG - Intronic
1138131027 16:54480264-54480286 AAAATTAATCCATAGGAGAACGG - Intergenic
1138800733 16:60025341-60025363 TCAACTCACCAATAGGAGAAAGG + Intergenic
1139259915 16:65581637-65581659 CAAATAACTCAATAGGAAAAAGG - Intergenic
1139628215 16:68209137-68209159 GAATTTCCTCAATATGAAAAAGG - Intronic
1140275328 16:73503624-73503646 TGATTTCCTGAATAGGGGAATGG + Intergenic
1146745968 17:35330301-35330323 TAAAATCCTCAATAAGATACTGG - Intergenic
1147227643 17:38992186-38992208 GACATTCCTCAATAGTAGAATGG - Intergenic
1147233104 17:39033819-39033841 TAAATACCTCAACAGAAAAATGG - Intergenic
1150527667 17:65939620-65939642 AAAATCACACAATAGGAGAAAGG + Intronic
1150917734 17:69453564-69453586 TAAATTACTTAAAAGGAGAGAGG - Intronic
1152852411 17:82645371-82645393 CAAAATCCTCAATAGAAAAATGG + Intronic
1152937332 17:83147655-83147677 AAAATTCCTCAATTTGACAAAGG - Intergenic
1153678263 18:7475474-7475496 TAAATATATCAATAGGAAAATGG - Intergenic
1153918034 18:9763029-9763051 TAAATTTAACAATAGCAGAAAGG + Intronic
1154934102 18:21033325-21033347 GAACTTCCTCAATATGATAAAGG + Intronic
1155321763 18:24626155-24626177 TAAATTCTTCAAGAAGGGAAAGG - Intergenic
1155395043 18:25378065-25378087 AGAACTCCTCAAGAGGAGAATGG - Intergenic
1155484743 18:26329504-26329526 CAAATTCCTGAATGGGAAAATGG - Intronic
1155553273 18:26989993-26990015 AAAGTTCATCAACAGGAGAATGG + Intronic
1155635896 18:27955012-27955034 GAAATTCCTGATAAGGAGAATGG + Intronic
1156135172 18:34028993-34029015 TAAATTGCTCAATAGAAGGATGG - Intronic
1156135287 18:34030431-34030453 TAAATTCCTCAATAGAAGGATGG + Intronic
1156274102 18:35565478-35565500 GAAATTCCTCAATCTGATAAAGG + Intergenic
1158119451 18:54032318-54032340 GAAAATCCTCAAGAGGAAAATGG + Intergenic
1159619014 18:70616076-70616098 TAAATTCCCCAATTGGGGGAAGG - Intergenic
1159857336 18:73604825-73604847 TAACTTCCTCAATTTGATAAAGG + Intergenic
1165345329 19:35244686-35244708 AAAATTCCTCAATGTGATAAAGG + Intergenic
1167127560 19:47560815-47560837 GACATCCCTCAATAGGTGAATGG + Intergenic
1168185989 19:54699566-54699588 CTGATTCCTCAATAGGAAAAAGG - Intronic
925770396 2:7276564-7276586 AACATTCTTCAAGAGGAGAACGG + Intergenic
927609175 2:24520232-24520254 TAAATTGCTTAAGAGTAGAATGG - Intronic
928462431 2:31486820-31486842 TAAATTCCTAAATGTGTGAAAGG - Intergenic
928583257 2:32730058-32730080 TAAATACCTCAATAGTAGTGAGG + Intronic
931137174 2:59415916-59415938 TAAAATACTCACTAAGAGAATGG + Intergenic
932134863 2:69219300-69219322 GAAATTCCCCAAAAGGAGAAAGG + Intronic
933764161 2:85695686-85695708 GGAGTTCCTCAATAGGAGAGGGG + Intronic
933814465 2:86054582-86054604 TAAATTCCTAAATAGACCAAAGG + Intronic
935024043 2:99259347-99259369 AAAATTCATCAACAGAAGAATGG + Intronic
936827005 2:116593997-116594019 TATATCCCTCAATAGATGAATGG - Intergenic
936849482 2:116878196-116878218 TAAATTCCTCCATGGAGGAAGGG + Intergenic
937246367 2:120496685-120496707 CACATTCCTCACTAGGAAAATGG - Intergenic
937434425 2:121868598-121868620 TAATTGCCTCAGTAGGAAAAAGG + Intergenic
938580039 2:132637576-132637598 GAAATTCCTCAGTAGGAAAAAGG + Intronic
938910352 2:135879718-135879740 TAACTTCCACAACAGGAGGAGGG + Intergenic
939431348 2:142112936-142112958 TAAATTTTGCAATAAGAGAATGG - Intronic
939845278 2:147236566-147236588 AACATTCTTCAACAGGAGAATGG - Intergenic
940470142 2:154087106-154087128 TAACTTTCTCAAAAGAAGAAAGG + Intronic
940674039 2:156706895-156706917 TAAACTCCCCAATACCAGAAAGG + Intergenic
940701469 2:157049304-157049326 AAAATTCCTCAATAATACAATGG - Intergenic
941576634 2:167240768-167240790 CAAACACATCAATAGGAGAAAGG - Intronic
941937263 2:170993950-170993972 TAAATGCCTCAAAAAGAGAAAGG + Exonic
944137535 2:196415232-196415254 TATATTCCTCGGTAGGAGACTGG + Intronic
946814010 2:223557259-223557281 TACATTCCTTAATAAGATAAAGG + Intergenic
947011208 2:225569032-225569054 TAAATTTCTTCATAGGGGAAGGG + Intronic
947089843 2:226497515-226497537 TAAATACAGCAATAAGAGAATGG - Intergenic
947317303 2:228874594-228874616 AAAAATATTCAATAGGAGAAGGG + Intronic
947545913 2:231010170-231010192 CAAATTGATTAATAGGAGAAAGG + Intronic
1168803575 20:659921-659943 TAAATTCCTTTGAAGGAGAAAGG - Intronic
1170381040 20:15760026-15760048 TGAATTTCTCAAAGGGAGAATGG - Intronic
1172142916 20:32736337-32736359 TAAGTTGCTTATTAGGAGAAAGG + Intronic
1173573239 20:44092046-44092068 TAAGTTCATCAATAGCAGTAGGG - Intergenic
1175490253 20:59375600-59375622 CATATTCCTCAATAGCAGGATGG - Intergenic
1177669295 21:24205498-24205520 TGAATTTCTAAATAGGAGACAGG - Intergenic
1179211595 21:39329546-39329568 GATATCCATCAATAGGAGAATGG + Intergenic
1179654952 21:42839159-42839181 CAAATTCCTGAGCAGGAGAATGG - Intergenic
1181983467 22:26782815-26782837 CAATTTCCTCATTAGTAGAATGG - Intergenic
1184456567 22:44614013-44614035 AATATCCATCAATAGGAGAAGGG + Intergenic
949412887 3:3785173-3785195 TAAATTCCTCAAAGGTAGAGAGG + Intronic
950241029 3:11370180-11370202 TAAATTCCTTTTTAGGAGAGTGG - Intronic
951014180 3:17711760-17711782 TAAATACATCAGTAGGAGATAGG - Intronic
952020227 3:29009886-29009908 TAATTTCTTAAATAGGAGAAAGG - Intergenic
952620162 3:35328574-35328596 TAAGTTCCTGAATAAAAGAAAGG - Intergenic
953139658 3:40215822-40215844 TTAATTCCTCAATAGGCATAAGG - Intronic
953500603 3:43429801-43429823 TAAATTCCTCAATAGGAGAATGG - Intronic
954627881 3:52032649-52032671 CAGATTCCTCATTAGGAAAATGG - Intergenic
954980872 3:54744282-54744304 TAAATTCCTCAAAATCAAAATGG - Intronic
955372522 3:58365858-58365880 TATATTCCTTAAAAAGAGAAGGG - Exonic
955801445 3:62690928-62690950 GACATTCCTTAGTAGGAGAATGG + Intronic
956383356 3:68689412-68689434 GAACTTCCTCAATATGATAAGGG - Intergenic
958739248 3:98048517-98048539 AAAATTCTTCTATAGGAGAAAGG + Intergenic
959661337 3:108872089-108872111 CAAATAACTCAATAGGAAAATGG + Intergenic
960536385 3:118819220-118819242 TAAATACCTTAAAAGAAGAATGG + Intergenic
960736963 3:120791745-120791767 TAAATTCATCAATAGCTGAATGG - Intergenic
961131931 3:124476782-124476804 TAAATGTCTCCATTGGAGAAAGG - Intronic
962551562 3:136497864-136497886 AAAATTCCTCAATCTGATAAGGG + Intronic
963324794 3:143850964-143850986 TAAATTACTCACCAGGAGAAGGG - Intergenic
963367467 3:144355298-144355320 AAAATCCATCAACAGGAGAATGG - Intergenic
963763989 3:149314686-149314708 AAAATTCATCAATGGGAGAGTGG + Intergenic
964704848 3:159607137-159607159 TGAACTCTTCAATAGGAAAATGG - Intronic
965094435 3:164206558-164206580 TTAATTCCTCTATATGAAAATGG + Intergenic
965707639 3:171525064-171525086 TAATTTCCTCAATTGTAAAATGG + Intergenic
966058069 3:175720509-175720531 TAAATTCCAGAATAAGAGACTGG + Intronic
966497519 3:180598058-180598080 TATATCCTTCAATAGGATAATGG + Intergenic
967056979 3:185837847-185837869 AAAACTCTTCAATAGAAGAATGG - Intergenic
968129825 3:196186548-196186570 TAAATTCCAGAACAGGAGAGTGG - Intergenic
968819680 4:2841195-2841217 TAACTTTCTAACTAGGAGAAGGG - Intergenic
970764132 4:19525837-19525859 TAAATTACTCATAATGAGAATGG + Intergenic
971054072 4:22893026-22893048 TAATTTCTTCAACAGGAAAACGG - Intergenic
971104903 4:23514072-23514094 GAAATTCATGAATAAGAGAATGG + Intergenic
972740844 4:41884735-41884757 TTAATGTCTCAATAGAAGAAAGG - Intergenic
972827811 4:42781382-42781404 TATGTTCCTCAATAGGGAAATGG + Intergenic
975720102 4:77240973-77240995 TGAATTCCTCGATATGCGAATGG + Intronic
977180866 4:93872178-93872200 TTAGTTGCTCAACAGGAGAAAGG - Intergenic
977966646 4:103157809-103157831 TAAAATATTCAATAGGAGACTGG - Intronic
979817080 4:125122033-125122055 TATATCCTTCAATAGGTGAATGG + Intergenic
979821198 4:125174310-125174332 TAAATTCTTCCATTGGAAAAAGG - Intergenic
980810928 4:137879240-137879262 GAAATTCCTCAATGTGATAAAGG + Intergenic
980919564 4:139069583-139069605 AAATTTCCTCCATAGGAAAATGG + Intronic
981005473 4:139870446-139870468 TAAATACATCAAAAGAAGAATGG - Intronic
983354617 4:166639698-166639720 TAATTTTCTCAATAGTAGCAGGG + Intergenic
983732712 4:171015964-171015986 TAAAGTCCTTAGTATGAGAATGG + Intergenic
983969847 4:173858119-173858141 TGACTTGCTCAATAGGGGAATGG + Intergenic
984578303 4:181477033-181477055 TAATTTGCTCAAGAGAAGAAAGG + Intergenic
985358973 4:189152401-189152423 TAAATCCCTCAAAAGCAGAGAGG - Intergenic
986180451 5:5388429-5388451 TGAATTCCCCAAAAGGAAAATGG + Intergenic
988486830 5:31674360-31674382 CAAGTTCCTCCAAAGGAGAAAGG - Intronic
989346665 5:40437970-40437992 TAAATTTATCTATTGGAGAAAGG + Intergenic
989748640 5:44863799-44863821 TAAATACCACATTAGGAAAATGG + Intergenic
990625598 5:57606574-57606596 GAAATTCCTCCACAGCAGAAGGG - Intergenic
991954268 5:71976813-71976835 TAAAATGCTCAATATGTGAAGGG + Intergenic
995938309 5:117546341-117546363 TGAATTTCTCAAAAAGAGAAGGG - Intergenic
996348061 5:122509030-122509052 TTAAATCCTCAATAAGAGCAAGG + Intergenic
996613530 5:125412569-125412591 TATATTCCTCAACAGACGAAGGG - Intergenic
998185093 5:139972847-139972869 TAAATACCTCAACAGAAAAATGG + Intronic
998232779 5:140371955-140371977 TAACTTCCTCAATAAGAACAAGG - Intronic
998564673 5:143206539-143206561 CAAATTCCACGAAAGGAGAAAGG + Intronic
999816886 5:155185936-155185958 TAATTTCTTCAAGTGGAGAAAGG + Intergenic
999983326 5:156978532-156978554 GACATTCCTCATTAAGAGAATGG - Intergenic
1001462395 5:171928648-171928670 TAACTTCCTCAATATGATAAAGG + Intronic
1001996370 5:176162864-176162886 GAAATTCCTCAACATGATAAAGG + Intergenic
1004039094 6:11957927-11957949 AATATTCCTTAAAAGGAGAATGG + Intergenic
1004796280 6:19089141-19089163 TAAATTCCTCCTTTGTAGAATGG - Intergenic
1007819028 6:44546647-44546669 AATATCCCTCAATAGGAGAGTGG + Intergenic
1008084051 6:47225231-47225253 CAGATTCCTCATTAGTAGAATGG + Intergenic
1009853261 6:69225742-69225764 TTATTTCCTCTATAGGAAAATGG - Intronic
1010026661 6:71226261-71226283 TAACTTCTTCCCTAGGAGAAGGG - Intergenic
1011946242 6:92907473-92907495 TAAATTCCTGAAGTGGAAAAGGG + Intergenic
1012568667 6:100694783-100694805 TAAATTAATAAATAGGGGAAAGG + Intronic
1012750139 6:103150928-103150950 TGAATTCCTCCATAGGATAATGG + Intergenic
1015810884 6:137161196-137161218 CAATTTCCTCATTAGTAGAATGG - Intronic
1017366152 6:153642132-153642154 TACATCCCTCAACAGGTGAATGG + Intergenic
1017598999 6:156060628-156060650 GAAAGTCCCCAGTAGGAGAAGGG + Intergenic
1019673861 7:2299096-2299118 TAGGTTCCTCGATAGGACAACGG + Intronic
1020483386 7:8690770-8690792 TAAATGCGTCAATATGAAAATGG - Intronic
1020569503 7:9841219-9841241 TAAATTCCTTAAGTGGAGCATGG - Intergenic
1021205175 7:17771357-17771379 TATATTCATCACTAGGGGAATGG + Intergenic
1021392508 7:20110726-20110748 TTAATTCCTAAATAGCAGATTGG + Intergenic
1022726041 7:32982544-32982566 AATATTCATCAATAGGGGAATGG - Intronic
1023056806 7:36297208-36297230 TCCATTCCTGAACAGGAGAAAGG - Intronic
1023301044 7:38771526-38771548 TCATTTCCTCATTAGGACAATGG + Intronic
1024039391 7:45539239-45539261 AAACTTCCTCAATATGATAAAGG + Intergenic
1025047561 7:55705109-55705131 AATATTCATCAATAGGGGAATGG + Intergenic
1025108714 7:56194599-56194621 TAGATTTCTCAAAAGGAAAATGG - Intergenic
1026016696 7:66677238-66677260 TAACTTCCTCAACATGATAAAGG + Intronic
1026193952 7:68155954-68155976 TCCATCCCTCAATAAGAGAATGG - Intergenic
1026213504 7:68327746-68327768 CAGATTGCTTAATAGGAGAAAGG - Intergenic
1027669591 7:81079080-81079102 TAAAATCTTCAATATGAGATTGG - Intergenic
1028055767 7:86240727-86240749 TAAGTTCCTATAGAGGAGAATGG + Intergenic
1028509418 7:91607336-91607358 TAAATTCCTCTGTAGAAAAATGG - Intergenic
1028788341 7:94822967-94822989 AATATTCCTCAAAAAGAGAAAGG + Intergenic
1029072759 7:97913404-97913426 TAAGTTCTGCAATAGGGGAAGGG - Intergenic
1029869385 7:103674288-103674310 TAATATCCTCAACAGGATAAGGG - Intronic
1030179528 7:106690796-106690818 TAAATTGCTAAATAAGAGGAAGG - Intergenic
1030657769 7:112186442-112186464 TAAATTTCTCACTAGTAAAAAGG + Intronic
1030844575 7:114393297-114393319 TAAACTGCTCAAAAAGAGAAGGG - Intronic
1031041315 7:116841246-116841268 AATGTCCCTCAATAGGAGAATGG + Intronic
1031291616 7:119944408-119944430 GATATTCATCACTAGGAGAATGG - Intergenic
1032149952 7:129419971-129419993 CACATTCCTCAAGAGCAGAAGGG - Intronic
1032795481 7:135272641-135272663 TAAATTCACCAAAAGGAGAATGG + Intergenic
1033759800 7:144426295-144426317 CATATTCCTCATTGGGAGAATGG + Intergenic
1034042647 7:147895797-147895819 TATATTCAGCAAGAGGAGAACGG - Intronic
1034044113 7:147909791-147909813 GAAATTCTACAATAAGAGAAGGG - Intronic
1034049247 7:147964659-147964681 AAAATGCCTCAAAAGGAGTAAGG - Intronic
1034407481 7:150914811-150914833 TAAATTTCTCAGAAGGAGAAGGG - Intergenic
1036014747 8:4770033-4770055 TTATTTCCTGAATGGGAGAAAGG - Intronic
1036463096 8:8971705-8971727 TAAATTCCTGGTTAGGAGAGTGG - Intergenic
1037141255 8:15522786-15522808 TAAATTCCTCACTAGAGAAAAGG - Intronic
1038457201 8:27683747-27683769 TATATCCATCAACAGGAGAATGG + Intergenic
1038643641 8:29347091-29347113 TAAATGCCTGAATTGGTGAAGGG - Intronic
1038657055 8:29462714-29462736 GAGATTCATCAATAGGAGAGTGG + Intergenic
1039674746 8:39649814-39649836 GAATTTCCTCACAAGGAGAAAGG - Intronic
1039934909 8:42033908-42033930 TAAATTCACTAATAGGAGACAGG + Intronic
1040939077 8:52814288-52814310 TAAATATCTAAATAGGAGAATGG - Intergenic
1042347203 8:67739838-67739860 TAAGCTCATCAATATGAGAAAGG + Intronic
1042894088 8:73647328-73647350 AACATCCCTCAATAGGTGAAGGG + Intronic
1043363842 8:79508070-79508092 TAAATTCATCTGTAGAAGAAAGG + Intergenic
1046940493 8:119926108-119926130 TATTTTCCTTAATAGAAGAAAGG + Intronic
1047983568 8:130209232-130209254 AAATTTCCTCACTAGTAGAATGG - Intronic
1051417528 9:16858182-16858204 TAAATACCTCAAAAGGAAAGGGG - Intronic
1053616158 9:39768687-39768709 AAAATTCATCAATAAAAGAATGG + Intergenic
1053874329 9:42527993-42528015 AAAATTCATCAATAAAAGAATGG + Intergenic
1053898286 9:42766595-42766617 AAAATTCATCAATAAAAGAATGG - Intergenic
1054237359 9:62573703-62573725 AAAATTCATCAATAAAAGAATGG - Intergenic
1054268006 9:62938761-62938783 AAAATTCATCAATAAAAGAATGG - Intergenic
1054551494 9:66608214-66608236 AAAATTCATCAATAAAAGAATGG - Intergenic
1054992206 9:71341580-71341602 TTGAATGCTCAATAGGAGAAGGG + Intronic
1055226050 9:73997578-73997600 TAAATGTCTCAATATGAGAATGG - Intergenic
1056199858 9:84264873-84264895 TAAATTCCTTAGGAGGAGGATGG + Intergenic
1056262202 9:84860194-84860216 GAAATACCTGAATATGAGAAGGG - Intronic
1057377461 9:94538061-94538083 AATATTCATCAAGAGGAGAATGG + Intergenic
1057577880 9:96258052-96258074 TAAGTTACTCCATAGAAGAATGG - Intronic
1057639637 9:96805796-96805818 AAATTTCCTCAATATGATAAGGG + Intergenic
1058490296 9:105491900-105491922 AAAAATCCTCAATAAGATAATGG - Intronic
1059371770 9:113845676-113845698 CAAATTCCTCAGAAAGAGAATGG + Intergenic
1059811100 9:117856482-117856504 TAATTTTCTCAATTGTAGAATGG - Intergenic
1061371221 9:130198601-130198623 TCAATTCCTCATTGGGAAAACGG + Intronic
1187794765 X:22991434-22991456 TAACTTCCTCAATATAATAAAGG - Intergenic
1188812547 X:34669260-34669282 TAAATTCAGCAGTTGGAGAAAGG + Intergenic
1189671080 X:43409404-43409426 GAAATTCTTCAATAGCAGAATGG - Intergenic
1189956521 X:46280612-46280634 GAACTTCCTCAATCTGAGAAAGG + Intergenic
1190023421 X:46900153-46900175 TAAAGGCCTTAATAGCAGAATGG - Intergenic
1190043748 X:47094972-47094994 GAACTTCCTCAATTTGAGAAAGG - Intergenic
1190605405 X:52137155-52137177 TAACTTCCTCAATCTGATAAAGG + Intergenic
1191047939 X:56159288-56159310 TAAAATCCTCAATAAAACAATGG - Intergenic
1191717504 X:64203938-64203960 TAAATTCCTCACTTGGGGGAAGG - Intronic
1193707177 X:84835867-84835889 TGAAGTCCTCAACAGGAAAACGG - Intergenic
1194571257 X:95556934-95556956 TAAATTCTTCTATAGTAGAATGG - Intergenic
1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG + Intergenic
1195380497 X:104266379-104266401 TAAATTCCATAACAGGTGAATGG - Intergenic
1195686397 X:107590480-107590502 GAACTTCCTCAATATGATAAAGG - Intronic
1195865811 X:109431724-109431746 TATATTCCTTAATAAGAGAGTGG - Intronic
1195951802 X:110283297-110283319 TAAATTCCTGAACCAGAGAAGGG - Intronic
1195973891 X:110504172-110504194 TAAATTCCTCAATTTGATAAAGG + Intergenic
1196704134 X:118702069-118702091 GAAATTTCTCAATAAGAAAACGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197077356 X:122368200-122368222 TAAATTCCTCAACCTGATAAAGG + Intergenic
1198735843 X:139784429-139784451 TAAATTCCTTAATGTCAGAATGG - Intronic
1199059113 X:143332195-143332217 TAAATTCCTGGCAAGGAGAATGG + Intergenic
1199474284 X:148228706-148228728 TACTTTCCTCTATAGGATAATGG - Intergenic