ID: 953500934

View in Genome Browser
Species Human (GRCh38)
Location 3:43433413-43433435
Sequence CTCAAACTGAAGTGCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953500934_953500935 11 Left 953500934 3:43433413-43433435 CCTGTGCTGCACTTCAGTTTGAG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 953500935 3:43433447-43433469 GTACATGTATCTTAAAAATAAGG 0: 1
1: 0
2: 2
3: 40
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953500934 Original CRISPR CTCAAACTGAAGTGCAGCAC AGG (reversed) Intronic
900467245 1:2831772-2831794 CTCAGAGTCCAGTGCAGCACTGG - Intergenic
901425184 1:9178215-9178237 CTCAGGCTGGAGTGCAGCAGTGG + Intergenic
904782454 1:32960971-32960993 CCCAAGCTGGAGTGCAGCAGTGG - Intronic
905049402 1:35036846-35036868 CTCAAATTGAATTACACCACTGG + Intergenic
906841820 1:49147393-49147415 CTCAAGCTGACATGCAGCAGTGG - Intronic
906968114 1:50480033-50480055 ATCAAACTGAAGTTTAACACTGG - Intronic
908530309 1:65027683-65027705 CTCAGACTGTGGTGCAGCTCTGG + Intergenic
911787844 1:101973212-101973234 CTCAGACTAAATTACAGCACTGG - Intronic
913711422 1:121487754-121487776 CTCCATCAGAAATGCAGCACTGG - Intergenic
917283524 1:173401635-173401657 CTCAGACTGAACTACACCACTGG + Intergenic
919389817 1:196968935-196968957 CCCAAGCTGAAGTGCAGTAGTGG - Intergenic
919823951 1:201490624-201490646 CTCAGGCTGCAGTGCAACACAGG + Intronic
920287183 1:204888891-204888913 CTCTAACTCTAGGGCAGCACAGG - Intronic
920926991 1:210351112-210351134 CTTGAACTGAATTGCACCACTGG - Intronic
921514519 1:216073367-216073389 CTCAAAATGTAGTGCTGCAGAGG - Intronic
922128401 1:222752498-222752520 CTCAAACTGATTTACATCACTGG + Intergenic
922204072 1:223431319-223431341 CTCAGACTGAATTACACCACCGG + Intergenic
1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG + Intronic
1071169512 10:82848086-82848108 ATCATATTGAAGTGCAGCAAAGG - Intronic
1073949185 10:108786471-108786493 CTCAAACTTCATTACAGCACAGG + Intergenic
1075158483 10:120001721-120001743 CTCATACTGAATTACACCACTGG - Intergenic
1077274526 11:1697692-1697714 CCAGAACTGAAATGCAGCACTGG - Exonic
1079764146 11:24369592-24369614 CTCAGACTGAATTACACCACAGG + Intergenic
1079943173 11:26707902-26707924 CAAAATCTGAAGTGCATCACTGG + Intronic
1080335683 11:31193119-31193141 CTCAGACTGAATTACATCACTGG + Intronic
1080534259 11:33206215-33206237 CTCAGACTGAATTACACCACTGG + Intergenic
1081154834 11:39677291-39677313 CCCAAACTGCACTGCAGAACTGG + Intergenic
1081204003 11:40253574-40253596 TTTAAAGAGAAGTGCAGCACAGG - Intronic
1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG + Intergenic
1086501305 11:87456457-87456479 GTCAAACTGAATTACAACACGGG - Intergenic
1090599561 11:128356370-128356392 CTCAAAGTGAAGTGTTGCACTGG - Intergenic
1091676542 12:2495092-2495114 CTCAAACTAAAATGAAACACTGG + Intronic
1091867341 12:3852017-3852039 CTCCAACAGACGTGCAGCAGAGG + Intronic
1092148561 12:6231625-6231647 CACAAACAGTAGAGCAGCACTGG - Intronic
1092250902 12:6895855-6895877 CTCAAACTGGAGTGCAGTTTGGG - Intronic
1093805877 12:23432373-23432395 CTCCGACTGAAGTGGAGCAAGGG + Intergenic
1095683712 12:45008064-45008086 CTCAGACTGAATTACAGCACTGG + Intergenic
1097884593 12:64716299-64716321 CTCAATCTGAAATGCTACACAGG + Exonic
1098746235 12:74240694-74240716 CTCAGACTGAATTCCACCACTGG + Intergenic
1101107686 12:101456173-101456195 CCCACACTGAAGTGCAGTAGTGG + Intergenic
1102366531 12:112341302-112341324 CTCAAACAGAAGTGCTGACCTGG - Intronic
1102765109 12:115426025-115426047 CTCAGGCTGGAGTGCAGCAGTGG - Intergenic
1103384528 12:120521634-120521656 CCCAGACTGCAGTGCAGCAGCGG - Intronic
1104196980 12:126549837-126549859 TTCAAACAGAAGTGCAGACCTGG + Intergenic
1104211426 12:126692246-126692268 CTCAGACTGAATTACACCACTGG - Intergenic
1104461631 12:128961273-128961295 CTCGGACTGAATTGCACCACTGG - Intronic
1104836178 12:131793127-131793149 CCCAAGCTGGAGTGCAGCAGTGG + Intronic
1107039271 13:35932296-35932318 CTCAGACTGAACTGTAACACTGG + Intronic
1107827528 13:44342236-44342258 CTCAGACTGAATTACACCACTGG + Intergenic
1115125880 14:29993304-29993326 CTCAAACTGAATTACACCACTGG - Intronic
1117233781 14:53750095-53750117 CTGTAACTGAAGTGGAGGACAGG + Intergenic
1117780124 14:59223457-59223479 CTACAAATGAATTGCAGCACCGG - Intronic
1118189580 14:63568426-63568448 CTCAGGCTGGAGTGCAGCAGTGG + Intergenic
1118891058 14:69909413-69909435 CTCAAAGTGAAGTCCATCAGAGG - Intronic
1118901583 14:69990719-69990741 CTCAAACTGGAGTCCAAAACAGG - Intronic
1119294894 14:73525067-73525089 CCCAGGCTGGAGTGCAGCACTGG + Intronic
1120848592 14:89148195-89148217 CTCAGACTGAATTACACCACCGG + Intronic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1122586102 14:102807572-102807594 CTCCAAGTGAAAGGCAGCACAGG - Intronic
1123723797 15:23082774-23082796 CTTAAACTGAAGTGCCACATTGG + Intergenic
1124460173 15:29882712-29882734 CTCAAACTGAATTGGACCAGTGG - Intronic
1125816992 15:42594146-42594168 CTCACACTGAAGTCCAGAATTGG - Intronic
1125913752 15:43465960-43465982 CTCACACTTAACAGCAGCACTGG + Intronic
1126901373 15:53318167-53318189 CTCAAACTGAATTATACCACTGG - Intergenic
1130920614 15:88341072-88341094 CTCAGATTGAACTGCACCACTGG + Intergenic
1131513882 15:93065018-93065040 CCCAGACTGGAGTGCAGCAGTGG + Intronic
1133524472 16:6590964-6590986 CCCAAAGTGTAGTCCAGCACTGG - Intronic
1134396006 16:13863947-13863969 CTCAGACTGAATTGCACCACTGG + Intergenic
1134585641 16:15408193-15408215 CTCAAAATGAAGTGCATAATTGG - Exonic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1136319673 16:29475435-29475457 CTCAAAATGAAGTGCATAATTGG - Intergenic
1136434244 16:30214779-30214801 CTCAAAATGAAGTGCATAATTGG - Intergenic
1137870720 16:51947610-51947632 CTCAAACGAAGGGGCAGCACTGG + Intergenic
1137976681 16:53038012-53038034 CTCAGACTGAATTACACCACTGG - Intergenic
1138554512 16:57763819-57763841 CTCAAGGTGAAATGCAGCCCTGG + Intronic
1139100812 16:63764215-63764237 CTCAAACTGAATTACACCACAGG + Intergenic
1140461725 16:75145564-75145586 CACAAACAGAAGAGCAGCAGAGG + Intergenic
1142602970 17:1065786-1065808 CTCAGGCTGGAGTGCAGCAGCGG + Intronic
1142725870 17:1813458-1813480 CCCAGGCTGTAGTGCAGCACTGG + Intronic
1144095729 17:11899026-11899048 ATCAAACTCAAGCACAGCACAGG + Intronic
1145817835 17:27808268-27808290 CTCAAGCTGAACTGCAGGGCAGG - Intronic
1146199506 17:30844169-30844191 CTCAGGCTGGAGTGCAGCGCCGG + Intronic
1151685696 17:75645313-75645335 CTCGCTCTGAGGTGCAGCACAGG + Intronic
1152437758 17:80286631-80286653 CACACACTGAGGTGCAGCCCAGG - Intronic
1157220702 18:45826785-45826807 CTCAGACTGGAGTCCAGCTCGGG + Intronic
1157740480 18:50088416-50088438 CTTAAATACAAGTGCAGCACTGG + Intronic
1159609517 18:70510348-70510370 CTCAGACTGAATTGTACCACTGG - Intergenic
1160215629 18:76927260-76927282 ATCAATCTGAAAAGCAGCACAGG - Exonic
1160286390 18:77547385-77547407 CACAAACAGATGGGCAGCACTGG - Intergenic
1163101646 19:15100930-15100952 CTGAAACTGAGGTGCAGGAGGGG - Intergenic
1164945016 19:32286094-32286116 CTCAAACCAAAATGCAGTACAGG + Intergenic
1166209576 19:41297558-41297580 CTCAAAATGGAGTACAGAACAGG + Intronic
1167675862 19:50884958-50884980 CACAAACAGAATTGCTGCACAGG + Intergenic
925695294 2:6570935-6570957 CTCAAACTGAATAGCTGAACAGG + Intergenic
930908835 2:56606073-56606095 CTCAAACAGACCTGCAGCTCAGG - Intergenic
932594439 2:73085505-73085527 TTCACACTGAGCTGCAGCACAGG - Intronic
933854647 2:86401595-86401617 CTCAGACTGAATTACAACACTGG - Intergenic
935963433 2:108449215-108449237 CGCAAACAGAAGTGCAGCGGTGG + Exonic
940809899 2:158230683-158230705 CTCGATATGAAGTGGAGCACGGG + Intronic
941255967 2:163231284-163231306 CTCAAACTACAGTGCAGTTCTGG + Intergenic
943556005 2:189404540-189404562 CTGAGACTGAATTGCACCACTGG + Intergenic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
946570127 2:221015342-221015364 CTCAAACTGAATTACACCATTGG - Intergenic
1169196397 20:3685014-3685036 CTCAAACTGAATCACACCACTGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171182681 20:23102476-23102498 CTCTAACTGAAGGGAAGCATGGG + Intergenic
1172384994 20:34527914-34527936 CTCTGACTGAAGTGGAGGACAGG - Intronic
1173029343 20:39340421-39340443 CATAAACTGACTTGCAGCACTGG + Intergenic
1173539841 20:43843082-43843104 AGGAAACTGAAGTGCAGCAGGGG + Intergenic
1173849621 20:46209861-46209883 CTCAAACTTAAGTTCAGAACTGG - Intronic
1173878771 20:46394772-46394794 CTTAAACTGAAGTGCCACATTGG - Intronic
1174060937 20:47832679-47832701 CTCAAACTAGAAAGCAGCACCGG + Intergenic
1174070793 20:47897701-47897723 CTCAAACTACACAGCAGCACCGG - Intergenic
1174070960 20:47898691-47898713 CTCAAACTAGAAAGCAGCACCGG - Intergenic
1174100357 20:48122290-48122312 CTCAAACTACACAGCAGCACCGG + Intergenic
1174100518 20:48123193-48123215 CTCAAACTACACAGCAGCACCGG + Intergenic
1174153273 20:48500955-48500977 CTCAAACTACACAGCAGCACCGG + Intergenic
1174322181 20:49750638-49750660 CAAAAGCTGGAGTGCAGCACTGG - Intergenic
1183223098 22:36529723-36529745 CTCAAACTTAATTGTAGGACAGG + Intergenic
1184751326 22:46488108-46488130 CTGAAACTGAGGTGCAGGGCAGG - Intronic
949408436 3:3738965-3738987 CACAAACTGAATTACACCACTGG + Intronic
950419687 3:12891530-12891552 CTCGAACTGAATTGCACCATGGG - Intergenic
951116834 3:18873273-18873295 CTAAATCTGAAATGCAGCATTGG + Intergenic
951795990 3:26538993-26539015 CTCAATCTGAAATGAAGCTCAGG + Intergenic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
953660073 3:44885477-44885499 CTGAAACTGGAATTCAGCACAGG + Exonic
954500710 3:51011851-51011873 CTCCAACTGACCTGCAGCTCAGG - Intronic
957034793 3:75283783-75283805 CTCAAAGAGAAGTGTAGCCCTGG + Intergenic
957343265 3:78928735-78928757 CTCAAATGGAAGTGTAGTACAGG - Intronic
959769863 3:110080634-110080656 CTCAGACTGAATTACACCACTGG + Intergenic
960193708 3:114739241-114739263 CTCAAACTGAATTGCACCTCAGG - Intronic
961078668 3:124005370-124005392 CTCAAACAGAAGTACAGCCCTGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961593882 3:128001372-128001394 CAGAAACTGAACTGAAGCACTGG + Intergenic
966087078 3:176080670-176080692 GCCACACTGAAGTGCAGCTCTGG - Intergenic
969928669 4:10609561-10609583 CTCACACAGAAGAGCAGCAGAGG + Intronic
971897367 4:32615064-32615086 CTCACACTGAATTACATCACTGG + Intergenic
972696596 4:41452472-41452494 CTGAAACTGAAATATAGCACTGG - Intronic
974842969 4:67319220-67319242 CTCAGACTAAATTGCACCACTGG + Intergenic
976250124 4:83041905-83041927 CCCAGGCTGAAGTGCAGCAGCGG + Intronic
977141250 4:93375254-93375276 CCCAGGCTGAAGTGCAGTACAGG + Intronic
977431886 4:96940409-96940431 GTCAAACAGAAGTGCACAACAGG + Intergenic
978640475 4:110865224-110865246 CTCAAAATAAATTTCAGCACTGG + Intergenic
979346714 4:119595696-119595718 CTCAGACTGAATTACACCACAGG + Intronic
979997147 4:127444562-127444584 CTCAGACTGAATTACACCACTGG + Intergenic
980259366 4:130427802-130427824 GTCAAAATGAAAGGCAGCACAGG + Intergenic
980415058 4:132476747-132476769 CTCAGACTGAATTACACCACTGG - Intergenic
984103343 4:175514226-175514248 CTCAAACTGAACTATACCACTGG - Intergenic
984430068 4:179637430-179637452 CTCCAACTGACCTGCAGCTCAGG + Intergenic
985051354 4:185995486-185995508 CTCAAACTCAAGTACATCACTGG - Intergenic
985713158 5:1441728-1441750 GTCAAACCCAAGAGCAGCACAGG + Intronic
987724380 5:21679081-21679103 CTCAGCCTGAAGTGCAGTGCTGG + Intergenic
988512094 5:31873392-31873414 CCCAAACTGGAGTACAGCAGTGG - Intronic
990383984 5:55241472-55241494 CTCAAACTGAAGTGCCAAACTGG - Intergenic
991246849 5:64517647-64517669 CTCACACTGAAAAGCAGAACAGG + Intronic
993013213 5:82507592-82507614 CTCAGACTGAATTACATCACTGG + Intergenic
994468360 5:100169218-100169240 CCAAATCTGAAGTGGAGCACAGG - Intergenic
996270889 5:121603034-121603056 CTCCAACAGACGTGCAGCAGAGG + Intergenic
996576230 5:124978998-124979020 CTCTAACTGACGTGCAGAACAGG + Intergenic
997039396 5:130233954-130233976 CTGGAACAGATGTGCAGCACTGG + Intergenic
999391243 5:151193284-151193306 CTCAAACTCAAATGAACCACTGG - Intronic
999474779 5:151888576-151888598 CCCAAACTGAAGTGCAGACAGGG + Intronic
1002377221 5:178797176-178797198 CCCTCACTGAGGTGCAGCACAGG + Intergenic
1003268377 6:4586553-4586575 TTGAAACTGAACTGCAGCATCGG - Intergenic
1005621531 6:27624865-27624887 CTCAGACTGAATTACACCACTGG + Intergenic
1005916931 6:30360453-30360475 CTCTAACTGACCTGCAGCAGCGG + Intergenic
1005918907 6:30381100-30381122 CTCAAATTTAACTGCAGCATTGG + Intergenic
1006431723 6:34001272-34001294 CTCAGGCTGGAGTGCAGCAGTGG - Intergenic
1006874463 6:37283259-37283281 CTGAAACAGGAGTGAAGCACAGG - Intronic
1010853805 6:80812794-80812816 CTCAGACTGAATTACACCACTGG - Intergenic
1014161896 6:118179275-118179297 CTCAAAATGAATTACATCACTGG - Intronic
1014454236 6:121619038-121619060 CTCAGACTGAATTACACCACTGG - Intergenic
1015517862 6:134102325-134102347 CTGAAAATGAAATGCAGCAAAGG - Intergenic
1017009547 6:150054018-150054040 CTCAAACTACACAGCAGCACTGG + Intergenic
1017582909 6:155886929-155886951 CTCAGACTGAATTACACCACTGG - Intergenic
1018371262 6:163170403-163170425 CTCAATCTGATGTTCAGCAGGGG - Intronic
1018694024 6:166376260-166376282 CTCAGACTGAGTTACAGCACTGG - Intronic
1021920720 7:25482250-25482272 CTCAAACTGAATTAGACCACTGG - Intergenic
1022871869 7:34488471-34488493 CTCCAACTTCAGTTCAGCACAGG + Intergenic
1023034788 7:36120821-36120843 CTCCAACTGAACTGCAGCTAAGG + Intergenic
1025233755 7:57219941-57219963 CTCAAACTACACAGCAGCACCGG - Intergenic
1026877477 7:73887758-73887780 CCCACACTGAAGTCCAGCCCTGG - Intergenic
1028580815 7:92408238-92408260 CCAAAACTGAAGGGCAGGACTGG - Intergenic
1028915503 7:96254391-96254413 CTCAAACTGAATTACACCATTGG + Intronic
1030071166 7:105698707-105698729 TTCAAACTGTAATGCAGTACTGG - Intronic
1031561384 7:123242967-123242989 CTCAAACTGAATTGCACTACTGG - Intergenic
1034647879 7:152664633-152664655 CTCAGACTGAATTACACCACAGG + Intronic
1034974275 7:155438819-155438841 CTCACAGTCAAGGGCAGCACTGG + Intergenic
1035146282 7:156820931-156820953 CTCAAGGTGAACTGCAGCACAGG + Intronic
1037293103 8:17372101-17372123 ATCATACTGAAGTGCATCTCTGG + Intronic
1038902201 8:31856840-31856862 CTCCAACAGAAGTGCAGCTGAGG - Intronic
1039512583 8:38103790-38103812 CTCAGGCTGGAGTGCAGCAGTGG - Intergenic
1041324358 8:56649237-56649259 CTCAAACTGAAATACATCACTGG + Intergenic
1041761295 8:61369711-61369733 TACAAACTGAAGTTCAGCAATGG - Intronic
1043360309 8:79464417-79464439 CTCAGACTGAAGTTCACCATTGG - Intergenic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1044182018 8:89207923-89207945 CTCAGACTGAATTACACCACAGG - Intergenic
1044704781 8:94998005-94998027 CTCTAACTCAAGAGCAGCCCAGG - Intronic
1045861095 8:106815733-106815755 CTCAGACTGAATTACACCACTGG + Intergenic
1048773740 8:137922853-137922875 CTCAGACTGAATTACACCACTGG - Intergenic
1050498486 9:6268877-6268899 CTCATGCTAAAGTGCAGAACAGG - Intergenic
1050957081 9:11678063-11678085 CTAAAAATGTACTGCAGCACTGG + Intergenic
1051674484 9:19545958-19545980 CTCCAACAGACCTGCAGCACAGG - Intronic
1054852837 9:69866330-69866352 CTCTAAGTGAATTGCACCACTGG - Intronic
1055130663 9:72770727-72770749 TTCAGACTGAATTACAGCACTGG - Intronic
1055755359 9:79552017-79552039 CTCAAGCTGAAGTGGAATACTGG - Intergenic
1056989117 9:91393445-91393467 CTCAAACTGATTTACATCACTGG - Intergenic
1057507859 9:95650914-95650936 CACAAACAGGAGTGCACCACAGG + Intergenic
1059102157 9:111482626-111482648 CATAAACTGAAGGGCAGCATTGG + Intronic
1060349102 9:122841969-122841991 CTCAGGCTGGAGTGCAGCAGTGG - Intergenic
1062711793 9:137978780-137978802 CTCAAACTGATGGGCAGCCTGGG - Intronic
1062720786 9:138042916-138042938 CTCAAAATGAGTTGCAGCAGTGG + Intronic
1188011447 X:25060533-25060555 CTCAAAATGAAGGGCATCAGTGG + Intergenic
1188251696 X:27903810-27903832 CTCAAACAGAAGTCAAGCACTGG - Intergenic
1189399977 X:40658385-40658407 TTAAAACTGAAGTGCAGGCCGGG - Intronic
1189558395 X:42168253-42168275 CTCAGACTGAATTACACCACTGG + Intergenic
1189567796 X:42261360-42261382 CTCAGACTGAATTACACCACTGG - Intergenic
1189615934 X:42784384-42784406 CTCAAACTTAATTACACCACTGG - Intergenic
1189867436 X:45345880-45345902 CTCAAATAAAAGTGCAGCATTGG + Intergenic
1193470192 X:81891483-81891505 CTGCAAATGAAGTGCAGCAATGG + Intergenic
1194362976 X:92977269-92977291 CTCAGACTGAATTACAACACAGG + Intergenic
1198026982 X:132716617-132716639 ATCAAACTGAAATGCATCACTGG - Intronic
1198680894 X:139181185-139181207 TTCAAATTGCAGTGAAGCACAGG + Intronic
1198904339 X:141544230-141544252 CTCAAACTAAATTACACCACTGG - Intergenic
1200671218 Y:6093500-6093522 CTCAGACTGAATTACAACACAGG + Intergenic