ID: 953503148

View in Genome Browser
Species Human (GRCh38)
Location 3:43457603-43457625
Sequence TAATTCCCACATATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10689
Summary {0: 1, 1: 82, 2: 1133, 3: 3449, 4: 6024}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953503148_953503154 2 Left 953503148 3:43457603-43457625 CCTCCCTCAATATGTGGGAATTA 0: 1
1: 82
2: 1133
3: 3449
4: 6024
Right 953503154 3:43457628-43457650 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
953503148_953503151 -3 Left 953503148 3:43457603-43457625 CCTCCCTCAATATGTGGGAATTA 0: 1
1: 82
2: 1133
3: 3449
4: 6024
Right 953503151 3:43457623-43457645 TTACAATTCAAGATGAGATTTGG 0: 2206
1: 9725
2: 12425
3: 11533
4: 7780
953503148_953503152 -2 Left 953503148 3:43457603-43457625 CCTCCCTCAATATGTGGGAATTA 0: 1
1: 82
2: 1133
3: 3449
4: 6024
Right 953503152 3:43457624-43457646 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
953503148_953503153 1 Left 953503148 3:43457603-43457625 CCTCCCTCAATATGTGGGAATTA 0: 1
1: 82
2: 1133
3: 3449
4: 6024
Right 953503153 3:43457627-43457649 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953503148 Original CRISPR TAATTCCCACATATTGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr