ID: 953506512

View in Genome Browser
Species Human (GRCh38)
Location 3:43490993-43491015
Sequence ATGCATATTAAGAGGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 7, 2: 57, 3: 192, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953506505_953506512 16 Left 953506505 3:43490954-43490976 CCCGATAAGATCTCAGGAGTTGG 0: 124
1: 276
2: 289
3: 244
4: 222
Right 953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG 0: 1
1: 7
2: 57
3: 192
4: 570
953506507_953506512 15 Left 953506507 3:43490955-43490977 CCGATAAGATCTCAGGAGTTGGA 0: 10
1: 112
2: 196
3: 237
4: 262
Right 953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG 0: 1
1: 7
2: 57
3: 192
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953506512 Original CRISPR ATGCATATTAAGAGGCAGAA TGG Intronic
900753080 1:4412140-4412162 ATGCCCAGTAAGAGGCATAATGG - Intergenic
900812981 1:4822015-4822037 ATGCACACTAAGAGGCAAAATGG + Intergenic
900813140 1:4823426-4823448 ATGCACACTAAGAGGCAAAATGG - Intergenic
902643808 1:17783948-17783970 CTGCAATTTGAGAGGCAGAATGG - Intronic
903147581 1:21384980-21385002 ATGCCCACTAAGAGGCAAAATGG - Intergenic
904999034 1:34653696-34653718 CTGCATAGTAAGATGAAGAAAGG + Intergenic
907079471 1:51608145-51608167 ATGCACACTAAGAGGCAAAATGG - Intronic
907253038 1:53155901-53155923 ATGCTCACTAAGAGGCAAAATGG + Intergenic
908990643 1:70084005-70084027 GAGCATTTTAAGAGGAAGAATGG - Intronic
909084334 1:71153917-71153939 ACGTACATTAAGAGGCAAAATGG + Intergenic
909178163 1:72386298-72386320 AAGCATATTAATAGGAAGAGAGG - Intergenic
909200859 1:72688512-72688534 ATGCACATTAAGAGGCAAAATGG - Intergenic
909220837 1:72959234-72959256 ATGCATTCAATGAGGCAGAAGGG + Intergenic
909350084 1:74641894-74641916 AATCATATGAAGAGGCACAAGGG + Intronic
909436853 1:75652028-75652050 ATGCTTATTAAGAGGCAAAATGG + Intergenic
909713101 1:78674253-78674275 ATGCTCATTAAGAGGCAAAATGG - Intergenic
910024107 1:82628376-82628398 ATGCGCATTAAGAGGCAAAATGG - Intergenic
910126859 1:83852029-83852051 TTCCATATCAAGAGGCAGCATGG + Intergenic
910802583 1:91160691-91160713 GTGCGCATTAAGAGGCAAAATGG - Intergenic
911452887 1:98087482-98087504 ATGCATATTTGGAGACACAAGGG + Intergenic
911645824 1:100336401-100336423 ATGCACTTTAAGAGGCAAAATGG + Intergenic
911699520 1:100935448-100935470 ATGCATTTTATGAAGCAGAGTGG + Intronic
911713944 1:101109337-101109359 GTGCACTTTGAGAGGCAGAATGG + Intergenic
911749571 1:101480991-101481013 AAGCACATTAAGAGACAAAATGG + Intergenic
911829016 1:102526510-102526532 ATGCATGTCCAGAGGAAGAATGG + Intergenic
911947893 1:104135718-104135740 GTGCACATTAAGAGGCAAAATGG + Intergenic
911960455 1:104295845-104295867 ATGCTCATTAAGAGACAAAATGG + Intergenic
912144880 1:106781276-106781298 ATACAAATTCAGAGGCAGAGAGG + Intergenic
912187212 1:107292618-107292640 ATGCTCACTAAGAGGCAAAATGG + Intronic
914984603 1:152445412-152445434 ATTTATATAAAGGGGCAGAACGG - Intergenic
915641705 1:157232570-157232592 ATGTGCATTAAGAGGCAAAATGG - Intergenic
916013257 1:160725740-160725762 ATGCGTACTAAAAGGCAAAATGG + Intergenic
916015529 1:160746481-160746503 CTTTATGTTAAGAGGCAGAAGGG + Intronic
916650794 1:166832581-166832603 ATGTACATTAAGAGGCAAAATGG + Intergenic
916816863 1:168362621-168362643 ATGTGCATTAAGAGGCAAAATGG + Intergenic
917310312 1:173671351-173671373 ATACACATTAAGAGTCAAAATGG + Intergenic
917543380 1:175937018-175937040 ATGCGTATTAAGAGACAAAATGG + Intergenic
918274600 1:182941764-182941786 AAGCATATTAAATGGCAGTATGG - Intronic
918725008 1:187909864-187909886 TAGCATTTTAAGAGGCAGGATGG - Intergenic
919168891 1:193929004-193929026 ATGCACACTAAGAGGCAAAATGG - Intergenic
920149980 1:203898102-203898124 ACGTATATTAAGAGGCAATAAGG + Intergenic
920832032 1:209474153-209474175 ATGTACAGTAAGAGGCAAAATGG + Intergenic
920879151 1:209864181-209864203 ATGCACATTACAAGGCAAAATGG - Intergenic
922630045 1:227097668-227097690 ATGCACACTAAGAGGCAAAATGG + Intronic
922687638 1:227657256-227657278 ATGCATAATAAAAGGCAAAGGGG - Exonic
922875349 1:228936064-228936086 ATGCGCACTAAGAGGCAAAATGG + Intergenic
923214510 1:231835940-231835962 ATGCATATTAATACACAGAGTGG - Intronic
923321253 1:232835818-232835840 ATGCTCATTAAGGGTCAGAAGGG - Intergenic
923383638 1:233445980-233446002 ATGCACGCTAAGAGGCAAAATGG + Intergenic
923384109 1:233449501-233449523 ATGCCCATTAAGAGGCAAAATGG + Intergenic
923965509 1:239134432-239134454 ATGCACACTAAGAGGCAAAACGG + Intergenic
924144301 1:241058168-241058190 ATGTGCATTAAGAGGCAAAATGG + Intronic
924437981 1:244061889-244061911 ATGCATGTGATGAGGGAGAATGG + Intergenic
1063165832 10:3461358-3461380 ATGCCTATTAAGATGCATCATGG + Intergenic
1063908136 10:10801676-10801698 AAGCATATTACAAGGCAAAAAGG + Intergenic
1064404948 10:15053387-15053409 ATGCGCACTAAGAGGCAAAATGG + Intronic
1064605418 10:17033972-17033994 ATGCATTCCAAGAGGAAGAATGG - Intronic
1065209710 10:23390840-23390862 ATGCCCACTAAGAGGCAAAATGG - Intergenic
1065216599 10:23455198-23455220 ATGCACACTAAGAGGCAAAATGG + Intergenic
1065534899 10:26707247-26707269 ATGCACACTAAGAGGCAAAATGG - Intronic
1065640396 10:27776446-27776468 ATGCACACTAAGAGGCAAAATGG - Intergenic
1066083156 10:31952364-31952386 ATGCACATTAAGAGGCAAAATGG - Intergenic
1066289361 10:33999694-33999716 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1066593405 10:37021073-37021095 AAGCTTATTAAGAGGGGGAATGG + Intergenic
1066598521 10:37078401-37078423 ATGTATGTTTAGAGGTAGAATGG + Intergenic
1066613889 10:37277428-37277450 TTGCATATTTAAAGTCAGAAAGG + Intronic
1067512240 10:46905745-46905767 ATGCACATTAACGGGCAAAATGG + Intergenic
1067650004 10:48146077-48146099 ATGCACATTAACGGGCAAAATGG - Intergenic
1068006223 10:51394512-51394534 CTGGATTTTAAGAGGCAGGAGGG + Intronic
1068182858 10:53545190-53545212 ATGCATATTAAAAGACAAAATGG - Intergenic
1068243963 10:54340936-54340958 ATGCACGTTAAGAGGCAAAATGG - Intronic
1068427093 10:56880682-56880704 ATGCACACTAAGAGGTAAAATGG + Intergenic
1068438403 10:57019773-57019795 ATGCACACTAAGAGGCAAAATGG + Intergenic
1068600818 10:58954583-58954605 ATGCACATTAAGAGGTAAAATGG + Intergenic
1068665881 10:59675611-59675633 ATGCTCACTAAGAGGCAAAATGG + Intronic
1068758222 10:60679484-60679506 ATGCACACTAGGAGGCAAAATGG + Intronic
1069107227 10:64397735-64397757 ACGCACATTAAGAGGCAAAACGG - Intergenic
1069118337 10:64536103-64536125 ATGCACATTAAGAGACAAAATGG - Intergenic
1069174363 10:65271720-65271742 ATGCACACTAAGAGGCAAAATGG - Intergenic
1069935527 10:71913140-71913162 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1070360678 10:75685512-75685534 ATGGATATGAATAGGCAGATAGG - Intronic
1070847341 10:79534114-79534136 ATGCACACTAAGAGGCAAAATGG - Intergenic
1070926455 10:80226178-80226200 ATGCACACTAAGAGGCAAAATGG + Intergenic
1071781862 10:88855126-88855148 ATGCACATTAAGAGGCAGAATGG - Intergenic
1071793280 10:88978987-88979009 ATGCTTATTAGGAGGATGAAAGG - Intronic
1072356600 10:94617704-94617726 ATGCACATTAACAGGCAAAACGG - Intergenic
1072520027 10:96223078-96223100 ATGCGCATTAAGAGGCAAAATGG + Intronic
1072531243 10:96321505-96321527 ATGCACATTAAGAGACAAAATGG - Intronic
1072597164 10:96884784-96884806 ATACATATGCAGGGGCAGAAGGG - Intronic
1073360063 10:102891090-102891112 ATGCACATTAAGAGGCAAAATGG - Intronic
1073748693 10:106499401-106499423 ATGCACACTAAGAGGCAAAATGG + Intergenic
1073849563 10:107599070-107599092 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1074395490 10:113094768-113094790 AAGCATATTAAGGGACAGGAGGG - Intronic
1074723672 10:116285734-116285756 ATGAATTCTAAGAGGCAGATGGG + Intergenic
1074769759 10:116725538-116725560 ATGCATATTCACAGATAGAAAGG + Intronic
1075081445 10:119386637-119386659 ATGCAGATGAAAACGCAGAAGGG - Intronic
1075240212 10:120771597-120771619 ATGTACACTAAGAGGCAAAATGG + Intergenic
1076103803 10:127804207-127804229 AAGCATTTTAAAAGGCACAAGGG + Intergenic
1076278813 10:129227858-129227880 CAGCATCTTGAGAGGCAGAAAGG + Intergenic
1076429823 10:130393949-130393971 GTGCACATTGAGAGGCAAAATGG + Intergenic
1078031488 11:7755968-7755990 ATAAAAATTAAGAGTCAGAAAGG + Intergenic
1078031685 11:7758535-7758557 ATAAAAATTAAGAGTCAGAAAGG + Intergenic
1078216969 11:9319785-9319807 ATGCACACTAAGAAGCAAAATGG - Intergenic
1079234594 11:18679096-18679118 ATGCACATTAAGAGGCAAAATGG + Intergenic
1079387082 11:19990033-19990055 ATTCACATTAAGAGGAAAAAGGG + Intronic
1079405943 11:20145837-20145859 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1079575986 11:22003570-22003592 ATGCAGTTTAAGAGGCAAAATGG + Intergenic
1079589728 11:22167535-22167557 ATGCACGTTAAGAGACAAAATGG - Intergenic
1079681722 11:23305133-23305155 ATGCACATCAAGAGGCCAAATGG - Intergenic
1079682809 11:23320120-23320142 ATGCACATTACGAGGCAAAATGG + Intergenic
1079894566 11:26102610-26102632 ATGCACATTAAGAGATAAAATGG - Intergenic
1080514229 11:33005222-33005244 AGGAATAATGAGAGGCAGAAAGG + Intergenic
1080553405 11:33393972-33393994 ATGCATATTTGTAGGCAGAATGG - Intergenic
1080952342 11:37049515-37049537 ATGCACACTAAGAGGCAAAATGG + Intergenic
1081139384 11:39478550-39478572 ATAAATATTTAGAGGAAGAATGG - Intergenic
1081159065 11:39731640-39731662 ATGCACATTAAGAGACAAAATGG - Intergenic
1081305059 11:41501813-41501835 ATGCACACTGAGAGGCAAAATGG - Intergenic
1082861782 11:57863854-57863876 ATGCATGCTAAGAGGTAAAATGG + Intergenic
1083482104 11:62955862-62955884 GTGCGCATTAAGAGGCAAAATGG + Intronic
1083562077 11:63681200-63681222 ATTCACATAAAGAGGCAGGAGGG + Intergenic
1084611220 11:70204071-70204093 AAGCATATTCCGAGACAGAAAGG - Intronic
1084748269 11:71187187-71187209 ATGCTGATTAACAGGCAGATTGG - Intronic
1085446730 11:76605700-76605722 ATGCACACTGAGAGGCAAAATGG + Intergenic
1085622741 11:78049779-78049801 ATGCATACTAAGAGGCAAAATGG - Intronic
1085894892 11:80627265-80627287 AAGCTTATTAAAAGGGAGAATGG - Intergenic
1086009207 11:82078454-82078476 ATGCACACTGAGAGGCAAAAGGG + Intergenic
1086203726 11:84234000-84234022 ATACACATTAAGAGGCAAAGTGG + Intronic
1086349607 11:85932442-85932464 ATGTACATTGAGAGGCAAAATGG - Intergenic
1087236568 11:95725305-95725327 AGGCATATTTAGAGGGAGAGGGG - Intergenic
1087237706 11:95738396-95738418 ATGCATATTATGAGCCAGGCCGG - Intergenic
1087571321 11:99930285-99930307 ATGCACAGTAAGAGACAAAATGG - Intronic
1088214903 11:107497172-107497194 ATGCATAGTAAGCCGAAGAAAGG - Intergenic
1088242061 11:107783066-107783088 ATGCACACTAAGATGCAAAATGG - Intergenic
1088253576 11:107882365-107882387 ATGCGCACTAAGAGGCAAAATGG + Intronic
1088555559 11:111057204-111057226 GTGCACACTAAGAGGCAAAATGG + Intergenic
1089771234 11:120804737-120804759 ATGCACATTAAGAGGCACTGGGG - Intronic
1090598598 11:128346150-128346172 ATGCATATGGAGAGGGGGAAAGG + Intergenic
1091099414 11:132856610-132856632 ATGCACACTATGAGGCAAAATGG + Intronic
1091331371 11:134733660-134733682 ATGCAGATGTAGTGGCAGAAGGG - Intergenic
1092575165 12:9774821-9774843 ATGCACACTAAGTGGCAAAATGG - Intergenic
1092580939 12:9840632-9840654 ATTAATATTAAGAGGGAGAAAGG + Intronic
1093007589 12:14067466-14067488 ATGCACACTAAGAGGCAAAATGG + Intergenic
1093421985 12:18984161-18984183 ATGCACACTAAGAGGCAAAATGG - Intergenic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1093872461 12:24308099-24308121 ATGCCTATTAAGAGGCAAAATGG + Intergenic
1094012980 12:25828548-25828570 ATGCACATTGAGAGAGAGAAGGG - Intergenic
1094044713 12:26154780-26154802 ATGCAGATTAAGGGGCAGAGAGG + Intronic
1094192051 12:27708008-27708030 GTGCACATTAAGAAGCAAAATGG + Intergenic
1094401872 12:30070352-30070374 ATGCACATTATGAGACAAAATGG - Intergenic
1094475185 12:30835319-30835341 ATGCAAATTAAGAGACAAAATGG + Intergenic
1095302629 12:40603321-40603343 TGGCATATGAAGAGGCAGTAAGG - Intergenic
1095304996 12:40628245-40628267 ATGCACATTAAGAGACACAATGG - Intergenic
1095375646 12:41525131-41525153 ATGCATATAAAGATGCTGAGTGG + Intronic
1096098525 12:48954695-48954717 AGGTAAATTTAGAGGCAGAATGG - Intronic
1096131191 12:49160228-49160250 ATGCACATTAAGAGGCAAAATGG - Intergenic
1096840352 12:54376052-54376074 AGGCATATTAAGGGATAGAAGGG - Intronic
1097134191 12:56837705-56837727 ATGCACCCTAAGAGGCAAAATGG - Intergenic
1097493726 12:60301498-60301520 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1097906191 12:64921918-64921940 ATGCGTGTTAAGAGACAAAATGG - Intergenic
1098437769 12:70486194-70486216 ATGTACATTAAGAGGCAAAATGG + Intergenic
1098846151 12:75538254-75538276 ATGCACACTAAGAGGCAAAATGG + Intergenic
1099175113 12:79412360-79412382 ATGCAAACTAAGAGGCAAGATGG - Intronic
1099450744 12:82803570-82803592 ATGCGCATTAAGAGACAAAATGG + Intronic
1099453963 12:82842136-82842158 ACACTTAATAAGAGGCAGAAAGG - Intronic
1099718603 12:86331485-86331507 ATGCACACTAAGAGGCAGAATGG - Intronic
1100046872 12:90393183-90393205 ATGCATATTCAGTGTCAGAGAGG - Intergenic
1100135840 12:91552339-91552361 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1100669647 12:96796291-96796313 AAGCATAATAAGAGCAAGAATGG - Intronic
1100758365 12:97777289-97777311 ATGTACACTAAGAGGCAAAATGG + Intergenic
1101296779 12:103432203-103432225 ATGCTTACTAAGAGGCAAAATGG - Intronic
1101516839 12:105444143-105444165 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1102614258 12:114139334-114139356 GTCAATAATAAGAGGCAGAAAGG + Intergenic
1102905272 12:116669846-116669868 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1103354424 12:120309338-120309360 ATGCTTAAGAAGAGACAGAATGG - Intronic
1103817222 12:123668393-123668415 ATACATAGTAAGAGGCAAGATGG - Intergenic
1104284483 12:127412265-127412287 ATGCACACTAGGAGGCAAAATGG - Intergenic
1105717408 13:23081188-23081210 ATGCAGAATAAAAGGCAGAGTGG - Intergenic
1106030724 13:25999779-25999801 ATGCATATGGATTGGCAGAAAGG + Intronic
1106587120 13:31067218-31067240 ATGCATTTCATGAGGAAGAAAGG - Intergenic
1106725446 13:32479801-32479823 ATGAAGATTAAGAGACAGAAGGG + Intronic
1107122871 13:36814396-36814418 ATGCACACTAAGAGACAAAATGG + Intergenic
1107307978 13:39043526-39043548 ATCCTTATTAAGAGAAAGAAGGG - Intronic
1107372169 13:39764903-39764925 ATGCAGATTAAAAATCAGAAAGG - Intronic
1107684732 13:42885681-42885703 ATGTACATTAAGGGGCAAAATGG - Intergenic
1107790344 13:43995677-43995699 ATGCGCATTAAGAGGTAAAATGG - Intergenic
1108483005 13:50894379-50894401 ATGCACACTAAGAGGCAAAATGG + Intergenic
1108718440 13:53105398-53105420 ATGCACATTAAGAGGCAAAATGG - Intergenic
1108920820 13:55672166-55672188 ATGCACACTAAGAGGCAAAATGG + Intergenic
1108954412 13:56134673-56134695 ATGCATAAAAATAGGTAGAATGG - Intergenic
1109331943 13:60941451-60941473 ATGCACATTAAGAGACAAAATGG + Intergenic
1109515414 13:63437572-63437594 ATGCACACTAGGAGGCAAAATGG - Intergenic
1109587190 13:64421889-64421911 AAGCAGATGAAGAGTCAGAAAGG + Intergenic
1109661122 13:65461993-65462015 ATGTGTATTAAGAGGCAGAATGG - Intergenic
1109848154 13:68024489-68024511 ATGCACACTAAGAGGCAACATGG - Intergenic
1110303398 13:73956178-73956200 ATGCTTATTAAGAGGCTGGCAGG - Intronic
1110979120 13:81873227-81873249 TTGCACACTAAGAGGCAAAATGG + Intergenic
1110993400 13:82072481-82072503 ATTCACAGTAAGAGGCAGAATGG + Intergenic
1111127883 13:83935620-83935642 ATGCAAACTAAGAGGCAAAATGG + Intergenic
1111135446 13:84036526-84036548 ATGCAAACTACGAGGCAAAATGG - Intergenic
1111150803 13:84251758-84251780 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1111151074 13:84254151-84254173 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1111344168 13:86926716-86926738 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1111850094 13:93562159-93562181 ATGCATAATAAAATGAAGAAAGG + Intronic
1111934662 13:94546797-94546819 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1112229185 13:97570584-97570606 ATGCATTCTATGAGGCATAATGG - Intergenic
1112871213 13:103973110-103973132 ATGCACACTAAGAGACAAAATGG - Intergenic
1113560309 13:111273470-111273492 ATGCACACTCAGAGCCAGAATGG - Intronic
1114426640 14:22629394-22629416 ATGCATATTAAGAGACAAAATGG + Intergenic
1114564680 14:23621659-23621681 ATGCACATCAAGAGGTAAAATGG + Intergenic
1115139784 14:30157134-30157156 ATATATGTTAAGTGGCAGAAAGG + Intronic
1115152801 14:30304657-30304679 ATGCATATAATGAGACAGACAGG + Intergenic
1115239385 14:31239946-31239968 ATGCACACTAAGAGGCAAAATGG - Intergenic
1115284597 14:31703419-31703441 ACACACATTAAGAGGCAAAATGG - Intronic
1116229779 14:42201823-42201845 ATGCGCATTAAGAAGCAAAATGG + Intergenic
1116307766 14:43280682-43280704 AAGCACAATAAGAGGCAGAGAGG - Intergenic
1116454611 14:45105326-45105348 ATGAATATTAAAACTCAGAATGG - Intronic
1117178470 14:53169078-53169100 ATGTACACTAAGAGGCAAAATGG - Intergenic
1117307827 14:54493592-54493614 ACGCCCATTAAGAGACAGAATGG - Intergenic
1117727743 14:58691188-58691210 ATGCAGACTAAGAGGCAAAATGG - Intergenic
1117944346 14:61001757-61001779 ATGAATATTAGAAGGAAGAAGGG - Intronic
1118422940 14:65627713-65627735 ACGCGTACTAAGAGGCAAAATGG - Intronic
1118670172 14:68117047-68117069 AGGCAAATTAAGTGGCAGAAAGG + Intronic
1118906420 14:70027042-70027064 AAGCCTATGCAGAGGCAGAAAGG + Intronic
1119064808 14:71514412-71514434 ATGTGCATTAAGAGGCAAAATGG - Intronic
1119153086 14:72383549-72383571 ATGCCTGTTAATAAGCAGAATGG - Intronic
1120208609 14:81612476-81612498 ATGCAGATTAAGAGGGAAAATGG + Intergenic
1120296413 14:82647460-82647482 ATGCTCACTAAGAGGCGGAATGG + Intergenic
1120376073 14:83708859-83708881 ATACACACTAAGAGGCAAAATGG + Intergenic
1120389029 14:83882005-83882027 ATGCATTTTGAAAGGGAGAAGGG - Intergenic
1120443999 14:84570539-84570561 ATTCCTAGTAAGATGCAGAATGG - Intergenic
1120652800 14:87154969-87154991 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1122144544 14:99681789-99681811 ATGCACACTAAGAGGCAAAATGG + Intergenic
1122533338 14:102444670-102444692 ATACCTATTAAGAGCCAGAATGG + Intronic
1123497099 15:20838250-20838272 ATGCATATTAAGAAGAAAACTGG + Intronic
1123590578 15:21849205-21849227 ATGCATATTAAGAAGAAAACTGG + Intergenic
1123825131 15:24073601-24073623 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1124827162 15:33108913-33108935 ATTCATATTGGGAGGCAGAGTGG - Intronic
1124841783 15:33248943-33248965 ATGTACATTAAGAAGCAAAATGG + Intergenic
1125041099 15:35188248-35188270 ATGCACACTAAGAGGCAAAATGG + Intergenic
1126260453 15:46683345-46683367 ATGCACACTAAGAGGCAAAATGG + Intergenic
1126301552 15:47202362-47202384 AGACACATTAAGAGGCAAAATGG + Intronic
1126553447 15:49959653-49959675 TTTCATATTAAGAGGCATAATGG + Intronic
1126949678 15:53867715-53867737 AATCATATTAATAGGCAGGAAGG - Intergenic
1127424919 15:58846050-58846072 ATGCATATTTGGAGGCAGGCAGG + Intronic
1127575164 15:60284836-60284858 ATGCACATTCAGAGGCAAAATGG - Intergenic
1127946942 15:63764881-63764903 ATGCACATTAAGAGGCAAAATGG + Intronic
1128822331 15:70670174-70670196 ATGCGCACTAAGAGGCAAAATGG + Intronic
1130626012 15:85516094-85516116 TTGCATCTGAAGAGACAGAAAGG - Intronic
1131010016 15:89009463-89009485 ATGCACATTAAGAGACAAAATGG + Intergenic
1132166911 15:99602449-99602471 ATGCGCATTAAGAGGCAAAATGG - Intronic
1202962680 15_KI270727v1_random:139082-139104 ATGCATATTAAGAAGAAAACTGG + Intergenic
1132716244 16:1291515-1291537 AGGCACACTAAGAGGCAAAATGG - Intergenic
1133560333 16:6944716-6944738 ATGTATGTCAAGGGGCAGAAAGG - Intronic
1134077682 16:11303523-11303545 ATGCATACTAAGAGGCAGAATGG + Intronic
1134606814 16:15577863-15577885 ATGCACATTAAGAGGCAAAATGG - Intronic
1134851633 16:17483589-17483611 ATGCACACTAAGAGGCAAAATGG + Intergenic
1135236559 16:20761795-20761817 ATGCGTACTAAGAGGCAAAATGG + Intronic
1135528614 16:23233275-23233297 ATGCTCATTAACAGGCAAAATGG - Intergenic
1135789025 16:25376462-25376484 ATGCACACTAAGAGGCAAAATGG - Intergenic
1136184007 16:28574441-28574463 ATGCACATTAAGAGACCAAATGG - Intronic
1137323029 16:47405558-47405580 ATGAAAGTTTAGAGGCAGAAAGG + Intronic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138261756 16:55628671-55628693 ATGCACACTAAGAGGCAAAATGG + Intergenic
1138261818 16:55629208-55629230 ATGCACAGTAAGAGACAAAATGG + Intergenic
1138988631 16:62362814-62362836 ATGCGTACTAAGAGGCAAAATGG - Intergenic
1139082314 16:63538062-63538084 ATGCATATTTGGAAGGAGAAAGG + Intergenic
1139151202 16:64383574-64383596 AGGGATATTAAGAGGTAAAATGG + Intergenic
1140270132 16:73458148-73458170 AGGCATAATAAGAGAGAGAAGGG - Intergenic
1141217234 16:82035942-82035964 ATAAATATTAATAGGCAAAATGG + Intronic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1143046718 17:4086779-4086801 ATGCAAACTGAGAGGAAGAAGGG + Intronic
1143842892 17:9748187-9748209 ATCAATAATAAGAGGCAGAAAGG - Intergenic
1144335662 17:14266986-14267008 ATGCATATGAGGAGGAAGGAAGG - Intergenic
1144389151 17:14777565-14777587 ATGCACAGTAACAGGCAGCAGGG - Intergenic
1144408000 17:14971603-14971625 ATGCTCACTAAGAGGCAAAATGG - Intergenic
1146513415 17:33470012-33470034 ATGCATAATACAAAGCAGAATGG + Intronic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1147633237 17:41946186-41946208 ATGCACATTAAGAGACAAAATGG - Intronic
1149100931 17:52905805-52905827 ATGCTTATTTAGAAGCAAAAAGG - Intergenic
1149736788 17:59002682-59002704 AAGCACATTAAAAGGCAGAAAGG + Intronic
1152316997 17:79586888-79586910 ATGCAAATTCAGAGTCATAAAGG - Intergenic
1153015236 18:577115-577137 ATGCGCATTAAGAGACAAAATGG - Intergenic
1153101539 18:1476060-1476082 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153745760 18:8178026-8178048 ATGCACACTAAGAGGCAAAGTGG - Intronic
1154044721 18:10894149-10894171 ATGTGCATTAAGAGGCAAAATGG + Intronic
1154067319 18:11119798-11119820 ATGCATTTTAAGCCACAGAAAGG - Intronic
1154112921 18:11585792-11585814 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1154455121 18:14514671-14514693 ATGCATATTAAGAAGAAAACTGG + Intronic
1155850364 18:30767024-30767046 ATACTCATTAAGAGGCAAAATGG - Intergenic
1156488714 18:37483708-37483730 AGGCTTATTACCAGGCAGAAAGG - Intronic
1156684088 18:39623245-39623267 ATGCACAGTAAAAGGCAAAATGG + Intergenic
1156832547 18:41511739-41511761 ATAAATACCAAGAGGCAGAATGG - Intergenic
1157269928 18:46265566-46265588 TTGGATATTAAGATGCAGAGGGG + Exonic
1157707255 18:49817930-49817952 ATGCTCACTAAGAGGCAAAATGG - Intronic
1157973017 18:52292812-52292834 ATGCACACTAAGAGGCAAAATGG - Intergenic
1158451327 18:57568289-57568311 ATGCATACTAAGAGGTAGAAAGG + Intronic
1158495100 18:57948210-57948232 ACACATATTAAGAGGCTGATAGG + Intergenic
1158595027 18:58808435-58808457 ATGCGCATTAAGAAGCAAAACGG - Intergenic
1159054871 18:63453532-63453554 ATGCACACGAAGAGGCAAAATGG - Intergenic
1159144984 18:64442568-64442590 ATGCACGTTAAGAGGCAAAATGG - Intergenic
1159745751 18:72232668-72232690 AAGTGTATTAAGAGGCAAAATGG - Intergenic
1160382013 18:78466961-78466983 ATAAATAATAAGAGGAAGAAAGG - Intergenic
1160934703 19:1588469-1588491 CTTCATCTTAAAAGGCAGAACGG - Intronic
1164612263 19:29640558-29640580 ACGCACATTAAGAGGCAAAATGG - Intergenic
1164863835 19:31587315-31587337 ATGCCCACTAAGAGGCAAAATGG - Intergenic
1166498120 19:43320008-43320030 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1167192114 19:47998477-47998499 ATGCGCATTAAGAGACAAAATGG + Intronic
1168042164 19:53767482-53767504 AAGCATATTAAATGGCAGCATGG - Intergenic
925553023 2:5096541-5096563 ATGCGCACTAAGAGGCAAAATGG - Intergenic
925751958 2:7096932-7096954 ATGCGCACTAAGAGGCAAAATGG - Intergenic
925806341 2:7653565-7653587 ATGCACACTAAGAGGCAAAATGG + Intergenic
926439670 2:12874797-12874819 ATGCGCACTAAGAGGCAAAATGG - Intergenic
926637302 2:15195764-15195786 ATGTACACTAAGAGGCAAAATGG + Intronic
926828256 2:16931465-16931487 ATGCACACTAAGAGGCAAAACGG - Intergenic
927277820 2:21276494-21276516 GTGCATATTACGAAGCAGCATGG + Intergenic
927339921 2:21971797-21971819 ATGCATATTTAGAATCAGAACGG + Intergenic
927412457 2:22842959-22842981 ATGCAAATAAAGACGCATAAGGG + Intergenic
928158862 2:28902678-28902700 ATGCAAATAAAGAGACAGGAAGG + Intronic
928992770 2:37252367-37252389 ATGCATATTTAGCAGCAGAGTGG + Exonic
929009242 2:37424721-37424743 ATGCGCATTAAGAGGCAAAATGG - Intergenic
929077100 2:38086883-38086905 ATGCATATTTAGAGGTAAAGGGG + Intronic
930298135 2:49580576-49580598 ATGAATATAATGAGGGAGAAAGG + Intergenic
930551878 2:52845994-52846016 ATACATATTAAATGGGAGAATGG - Intergenic
930591018 2:53326415-53326437 ATGCACATTAACAGGCTAAATGG + Intergenic
931114387 2:59148691-59148713 ATGTGCATTAAGAGGCAAAATGG + Intergenic
931272781 2:60717417-60717439 ATGCTCATTAAGAGACAAAATGG - Intergenic
931278342 2:60764365-60764387 ATGCAGATTAAGGGGCAGAAAGG - Intronic
931646524 2:64426859-64426881 ATGCAAATTAAAAGTCACAATGG - Intergenic
931884989 2:66607519-66607541 ATGCGCATTAAGAGGCAAAATGG + Intergenic
932005541 2:67923624-67923646 ATGCACACTAAGAGGCAAAATGG + Intergenic
932827604 2:74956229-74956251 ATGCACACTAAGAGGCAAAATGG - Intergenic
933064853 2:77780318-77780340 ATGTGCATTAAGAGGCAAAATGG - Intergenic
933069152 2:77835986-77836008 ATGGATACTAAGAGGAAAAATGG + Intergenic
933369464 2:81396786-81396808 ATGCACATTAAAAGGAAAAATGG + Intergenic
933439670 2:82296891-82296913 ATTCATGTTAGGAGGCAGAGAGG + Intergenic
933515186 2:83291379-83291401 ATGTACATTAAAAGGCAAAATGG - Intergenic
933936422 2:87207518-87207540 ATGCAGACTAAGAGGCAAGATGG - Intergenic
934144914 2:89082863-89082885 ATGTATAATAAGAGTCACAAAGG - Intergenic
934224345 2:90117689-90117711 ATGTATAATAAGAGTCACAAAGG + Intergenic
934887702 2:98039328-98039350 ATGCATACTAAGAGGCAAAATGG + Intergenic
935189177 2:100762182-100762204 ATGCATTTTGAGAGGAAGAAGGG - Intergenic
935300076 2:101686321-101686343 ATGCACATTAAGAGACAAAATGG - Intergenic
935324032 2:101919584-101919606 ATGTATATTGAGATGCAGATAGG + Intergenic
935827867 2:106969405-106969427 ATGCGCATTAAGAGGCAAAATGG - Intergenic
935957399 2:108391081-108391103 ATGCACATTAAGAGACAAAATGG + Intergenic
936035152 2:109105214-109105236 ATGTGCATTAAGAGGCAAAACGG + Intergenic
936356727 2:111758311-111758333 ATGCAGACTAAGAGGCAAGATGG + Intergenic
936837749 2:116728176-116728198 ATGTACACTAAGAGGCAAAATGG + Intergenic
937340970 2:121090308-121090330 ATGCACATTAAGAGACAAAATGG - Intergenic
937637813 2:124176498-124176520 AGGCAGATTAATAGGAAGAAAGG + Intronic
937713041 2:124999492-124999514 ATGTATATGATGAGTCAGAAAGG + Intergenic
938016197 2:127869318-127869340 ACAGGTATTAAGAGGCAGAAAGG + Intronic
938749250 2:134313120-134313142 ATTCATATTAAGAAGCGAAAGGG - Intronic
938835336 2:135097177-135097199 ATGCTTACTAAGAGACAAAAGGG - Intronic
939035322 2:137123638-137123660 ATGCATGTTGAAAGGAAGAAAGG + Intronic
939131214 2:138237693-138237715 ATGCACACTAAGAGGCAAAAAGG + Intergenic
939160477 2:138582901-138582923 ATGCACATTAAGAAGCAAAATGG - Intergenic
939207705 2:139128873-139128895 ATGCACACTAAGAGGCAAAATGG - Intergenic
939454100 2:142410725-142410747 ATGCACATTAAGAGACAAAATGG + Intergenic
939497642 2:142942990-142943012 ATGTACATTAAGAGGCAAAATGG - Intronic
939577111 2:143909127-143909149 ATGCACACTAAGAGGCAAAATGG + Intergenic
939696469 2:145331355-145331377 ATTCAAATTAAGTGGCAGGATGG + Intergenic
939800160 2:146698402-146698424 ATGCTCATTAAGTGGCAGAAGGG + Intergenic
940117576 2:150225844-150225866 ATGCATATTAAGAGACAAAATGG - Intergenic
940398403 2:153220388-153220410 ATGTGCATTAAGAGGCAAAATGG + Intergenic
940566153 2:155363563-155363585 ATGCGCATTTAGAGGCAAAATGG + Intergenic
940782931 2:157952538-157952560 ATGCACACTAAGAGGCAAAATGG + Intronic
940857641 2:158741982-158742004 ATGCGCATTAAGAGGCAAAATGG + Intergenic
941421477 2:165287427-165287449 ATGCACATTAAGAGGCAAAATGG - Intronic
941685079 2:168439973-168439995 ATGCCGATTAAGAGGCAAAATGG - Intergenic
943068959 2:183119046-183119068 ATGCATATTAAGAGGCAAAATGG - Intronic
943496899 2:188631412-188631434 ATGTACACTAAGAGGCAAAATGG + Intergenic
943499898 2:188674660-188674682 ATGCACACTAAGAGGCAAAACGG + Intergenic
943750281 2:191503314-191503336 ATGCACGTTAAGAGGCAAAATGG + Intergenic
943894426 2:193336222-193336244 ATGCATATTATTAGAAAGAAGGG - Intergenic
944757983 2:202783822-202783844 ATGAATATTTAGTGGCAGAGAGG + Intronic
944914472 2:204344040-204344062 GTGCACATTAAGAGGCAGAATGG + Intergenic
945300903 2:208215568-208215590 TTGCACACTAAGAGGCAAAATGG - Intergenic
945342556 2:208674330-208674352 ATGTGCATTAAGAGGCAAAATGG - Intronic
945555603 2:211271540-211271562 ATGTGCATTAAGAGGCAAAATGG - Intergenic
945582237 2:211609726-211609748 ATGCAAATTAATAGGAGGAAAGG - Intronic
947156938 2:227172105-227172127 ATGCACATTAAGAGGCAAAATGG - Intronic
948184771 2:236012306-236012328 TTACATATAAATAGGCAGAATGG - Intronic
948230673 2:236346864-236346886 ATGTGCATTAAGAGGCAAAACGG + Intronic
948306915 2:236955152-236955174 ATGCGCCTTAAGAGGCAAAATGG + Intergenic
1169429315 20:5522352-5522374 ATGCCTACTAAGAGGCAAAATGG + Intergenic
1169519934 20:6360074-6360096 ATGCACATTAAGAGACAAAATGG + Intergenic
1169708741 20:8537362-8537384 ATGTACATTAAGAGGCAAAATGG - Intronic
1170497423 20:16939794-16939816 ATGCACATTAAGAGGCAAAATGG + Intergenic
1170498373 20:16949054-16949076 ATGTATTTTAAAAGGTAGAATGG + Intergenic
1170734067 20:18998539-18998561 ATGCACACTAAGAGGCAAAATGG + Intergenic
1171060318 20:21950820-21950842 ATGCATTTTAAAATGTAGAAGGG - Intergenic
1171450337 20:25231377-25231399 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171450851 20:25235268-25235290 ATGAATATCTAAAGGCAGAATGG + Intergenic
1172165060 20:32893880-32893902 GCCCATAATAAGAGGCAGAAAGG + Intronic
1173490831 20:43479848-43479870 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1173704964 20:45103304-45103326 ATGTATATTATATGGCAGAAGGG - Intergenic
1174013141 20:47466997-47467019 ATGGGAATTAAGAGGCAAAATGG - Intergenic
1174108012 20:48176755-48176777 AGGCAAATGAAGAGGCACAAAGG - Intergenic
1174108121 20:48177483-48177505 AGGCAAATGAAGAGGCACAAAGG + Intergenic
1175634649 20:60570208-60570230 ATGAATGTTTAGAGGCAAAAAGG - Intergenic
1176819047 21:13638607-13638629 ATGCATATTAAGAAGAAAACTGG - Intronic
1177149685 21:17443025-17443047 AGGCAGATTAATAGGCAAAATGG + Intronic
1177547557 21:22578748-22578770 ATGCACACGAAGAGGCAAAATGG + Intergenic
1177730546 21:25023230-25023252 ATGCACATTAAGAGGAAAAATGG - Intergenic
1177939056 21:27386218-27386240 ATGCACATTAAGAGGCAAAATGG - Intergenic
1178117107 21:29428688-29428710 ATGCACATTAAGCGACAAAATGG - Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178524751 21:33318186-33318208 ATGCACATTAAGAGACAAAACGG + Intergenic
1178927006 21:36784614-36784636 ATGCATTTTAAGAGGCTGGCCGG - Intronic
1179155209 21:38844293-38844315 ATGCATATTAAAAGTGAGATAGG - Intergenic
1179254864 21:39706887-39706909 ATGCACAATAAGAGGAAAAATGG - Intergenic
1180128829 21:45811617-45811639 ATGAATATTAGCAGGTAGAAAGG - Intronic
1180722882 22:17922460-17922482 AGGCATATTAGGAGTCTGAATGG + Intronic
1181448901 22:23002876-23002898 ATGCATGTTAAGAGTAAAAATGG + Intergenic
1181495090 22:23283212-23283234 ATGCAGACCAAGATGCAGAAAGG + Intronic
1183137128 22:35899682-35899704 ATTCACATTAAGAGACAAAAAGG + Intronic
1185137779 22:49082853-49082875 ATGGAAATGAAGAGACAGAACGG + Intergenic
949396242 3:3617255-3617277 ATGCACACTAAGAGGCAAAATGG + Intergenic
949566798 3:5252680-5252702 ATGCATCTTAAGAGTCTGATGGG - Intergenic
949642219 3:6049467-6049489 ATGCACATTAAGAGGCAAAATGG - Intergenic
950628114 3:14263354-14263376 ATGTGCATTAAGAGGCAAAACGG - Intergenic
950907858 3:16555303-16555325 ATGCACACTAAGAGGCAAAATGG + Intergenic
951138379 3:19130991-19131013 ATGCACATTAAGAGACAAAATGG + Intergenic
951155010 3:19341246-19341268 ATGCACACTAAGAGGCAAAATGG - Intronic
951250766 3:20391806-20391828 ATGCGCATTAAGAGACAAAATGG - Intergenic
951462000 3:22961247-22961269 ATGCATATTATGAGCTAGAAGGG + Intergenic
952051176 3:29386331-29386353 ATAAATATTGAAAGGCAGAAAGG - Intronic
953013979 3:39054879-39054901 ATGCATTTTAAAAGTCAGGAAGG + Intronic
953194498 3:40719848-40719870 ATGCGCACTAAGAGGCAAAATGG + Intergenic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
953790036 3:45940379-45940401 ACGCACACTAAGAGGCAAAATGG + Intronic
953798190 3:46001512-46001534 TTGGATATTAAGGGGTAGAAGGG - Intergenic
954476992 3:50756271-50756293 ATGCACATTATGAGGCAAAATGG - Intronic
955490185 3:59474053-59474075 GTGAATATTGAGAGGCAGAAAGG - Intergenic
955548678 3:60059251-60059273 ATGCGCATTAAGAGACAAAATGG + Intronic
956948467 3:74252412-74252434 AGGCAGATTAAGAGGAAAAAAGG + Intergenic
957189638 3:76990784-76990806 ATGCATATCAAGAGGCAAAACGG + Intronic
957275037 3:78080375-78080397 ATGAGTAGTAAGAGGCAGAGCGG + Intergenic
957279921 3:78137267-78137289 GTGCACATTAAGAGGCAAAATGG - Intergenic
957315411 3:78570027-78570049 ATGCGCACTAAGAGGCAAAAGGG - Intergenic
957318268 3:78595552-78595574 ATGGATAATAAGAGGCATTAAGG + Intergenic
957655247 3:83065759-83065781 ATGCATATTAAGTAACAAAAAGG + Intergenic
957687190 3:83516631-83516653 ATGCACATTAAGAGGCAAAATGG + Intergenic
957847267 3:85754167-85754189 GTGCACATTAAGAGACAAAATGG - Intronic
958151230 3:89697092-89697114 ATGCATATTAAGAGGCAAAATGG + Intergenic
958492710 3:94797762-94797784 ATGTGCATTAAGAGGCAAAAAGG - Intergenic
958510568 3:95041655-95041677 AAGAATATTAATAGGAAGAATGG - Intergenic
958603716 3:96331713-96331735 ATACACATTAAGAGACAAAATGG + Intergenic
959053881 3:101550407-101550429 ATGCACATTAAGAGACAAAATGG + Intergenic
959194830 3:103166828-103166850 ATGCACTTTAAGAGGCAAAATGG + Intergenic
959294762 3:104521528-104521550 ATGCACATTAAGAAGCAAAATGG - Intergenic
959425479 3:106182041-106182063 ATTCAGATTGCGAGGCAGAAGGG - Intergenic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
960648396 3:119916776-119916798 AAGGATATTAACAGGAAGAATGG - Intronic
961132629 3:124483069-124483091 ATGCCTATTTTAAGGCAGAAGGG + Intronic
961353324 3:126317478-126317500 ATACACACTAAGAGGCAAAATGG + Intergenic
962059753 3:131913318-131913340 ATGCATATTAAGAGCCAAAATGG + Intronic
962209309 3:133463633-133463655 ATGCACACTAAAAGGCAAAATGG - Intronic
963584217 3:147163902-147163924 ATGCACATTAAGAGACAAAATGG - Intergenic
963684875 3:148420609-148420631 ATGCGCACTAAGAGGCAAAATGG - Intergenic
963764863 3:149324149-149324171 ATGCAGATTAGGAGGTAGCAGGG - Intronic
963943005 3:151114127-151114149 ATGCATATTTTAAGTCAGAAAGG - Intronic
964207327 3:154188949-154188971 ATGCATTTTAAGATGCTTAAGGG + Intronic
964249754 3:154699354-154699376 ATGTGTATTAAGAGGCAAAATGG + Intergenic
964709648 3:159658075-159658097 GTGCATATGGAGAGGAAGAATGG + Intronic
964915668 3:161838502-161838524 ATGCAAACTGAGAGGCAAAATGG - Intergenic
964951717 3:162303179-162303201 ATGTGTACTAAGAGGAAGAATGG + Intergenic
965376105 3:167926305-167926327 ATGTGTATTAAGAGGCAAAATGG + Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965933804 3:174080671-174080693 ATGCACACTAAGAGGCAAAATGG - Intronic
966162572 3:176983777-176983799 ATTCATGTTAAGAGACAAAATGG + Intergenic
966218532 3:177527524-177527546 ATGCACGCTAAGAGGCAAAACGG + Intergenic
966233686 3:177676595-177676617 ATACATATTAAAAGGCCCAAAGG - Intergenic
966566074 3:181382954-181382976 ATGCTCACTAAGAGGCAAAATGG - Intergenic
967120828 3:186381348-186381370 ATGTACACTAAGAGGCAAAATGG + Intergenic
967430802 3:189383124-189383146 ATGCACCCTAAGAGGCAAAATGG - Intergenic
967751381 3:193119911-193119933 ATGCACATTAAGAGGGAAAATGG + Intergenic
969199646 4:5592661-5592683 ATGTGCATTAAGAGGCAAAATGG + Intronic
969847748 4:9932885-9932907 ATGCATCGTTAGAGGAAGAAAGG + Intronic
970370295 4:15399102-15399124 ATGTGCATTAAGAGGCAAAATGG - Intronic
970398537 4:15695823-15695845 ATGTACATTAAGAGACAAAATGG - Intronic
970471121 4:16380270-16380292 ATGCAAACTAAGAGGCAAAATGG - Intergenic
970713656 4:18894544-18894566 ATGCACTTTAAGATGGAGAAAGG + Intergenic
970798641 4:19945886-19945908 ATGCATATTAAGAGGCAAAATGG + Intergenic
970998900 4:22300587-22300609 TTGCTTAGGAAGAGGCAGAAGGG - Intergenic
971147977 4:23999923-23999945 ATCTATATTAAGTGGCAGATTGG + Intergenic
971170009 4:24224257-24224279 ATCCATAGAAAGAGGGAGAATGG + Intergenic
971671031 4:29558332-29558354 ATGCGCATTAAGAGGCAAAATGG + Intergenic
971851314 4:31989283-31989305 AAGCACATTGAGAGGCAAAATGG + Intergenic
972003402 4:34067744-34067766 ATGCACATTAAGAGAAAAAATGG + Intergenic
972016356 4:34250883-34250905 ATGAATACTAAGAGGCAAAATGG - Intergenic
972329863 4:38055022-38055044 ATGCGCATTAAGAGGCAACATGG - Intronic
972411782 4:38802360-38802382 ATGCATACCAAGAGGCAAAATGG + Intronic
972865072 4:43221908-43221930 ATGCACATTAAGAGGCAAACTGG - Intergenic
973003899 4:44986733-44986755 ATGCACATTGAGAGGCAAAATGG + Intergenic
973146988 4:46839480-46839502 ATTATTATTAAGAGGCAGTAAGG + Intronic
973573670 4:52264988-52265010 ATGCACACTAAGAGGCAAAATGG - Intergenic
973702564 4:53551456-53551478 ATGCGCACTAAGAGGCAAAATGG + Intronic
973812658 4:54586890-54586912 ATGTACACTAAGAGGCAAAATGG - Intergenic
974098606 4:57392591-57392613 CTGCATATTAAGAGGCAAAATGG + Intergenic
974332564 4:60499155-60499177 ATGCACATTCAGAGGCAAAATGG - Intergenic
974462313 4:62204195-62204217 ATGCACACTAAGAGGCAAAATGG + Intergenic
974608686 4:64186249-64186271 ATGCACATTCAGAGGCAAAATGG + Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974674421 4:65072052-65072074 ATGCATACTAAGAGGCAAAATGG + Intergenic
974691275 4:65300427-65300449 ATGCACATTAAGAGACAAAATGG - Intergenic
974840053 4:67288998-67289020 ATGCACAATAAGATGCAAAATGG + Intergenic
974955165 4:68630531-68630553 ATGCACATTAAGAGGCCAAATGG + Intronic
975100981 4:70512724-70512746 ATGCACATTAACAGACAAAATGG - Intergenic
975222881 4:71833523-71833545 ATGTACATTAAGGGGCAAAATGG - Intergenic
975703553 4:77089705-77089727 ATGCACATTAAGAGGCAAAATGG - Intergenic
975767271 4:77682007-77682029 ATGCGCACTAAGAGGCAAAATGG - Intergenic
975856749 4:78632758-78632780 ATGCACATTGAGAGACAAAATGG + Intergenic
976299017 4:83500590-83500612 ATGCGCATTAAGAGACAAAATGG - Intronic
976818217 4:89174855-89174877 ATGCCCATTAAGAGACAAAATGG + Intergenic
977523060 4:98110358-98110380 ATGCACACTAAAAGGCAAAATGG + Intronic
977780432 4:100975282-100975304 ATGCAAATCAAGAGGTAGATTGG - Intergenic
977869249 4:102070432-102070454 ATGCACATTAAGAGATAAAATGG - Intronic
978938611 4:114410574-114410596 ATGCTCACTAAGAGGCAAAATGG - Intergenic
978979295 4:114922241-114922263 ATGCACAGTAAGAGGCAAGATGG + Intronic
979093965 4:116520526-116520548 ATGCACACTAAGAGGCAAAGTGG - Intergenic
979125754 4:116969739-116969761 ATGAGTATTAAGAGACAAAATGG - Intergenic
979154101 4:117360608-117360630 ATGCGCACTAAGAGGCAAAATGG - Intergenic
979154182 4:117361297-117361319 ATGCGCACTAAGAGGCAAAATGG + Intergenic
979358321 4:119731901-119731923 CTGCGTATTAAAAGGCAAAATGG + Intergenic
979397282 4:120203631-120203653 ATGCACACTAAGATGCAAAATGG - Intergenic
979430526 4:120624253-120624275 ATGCATATTAACCTGCAGAAGGG - Intergenic
979530959 4:121768845-121768867 AAGCATTTTAAAAAGCAGAAAGG + Intergenic
979960182 4:127009566-127009588 TTGCATATTTAGAGTCAGAGAGG + Intergenic
979997745 4:127452646-127452668 ATGCATGTAAAGAAGTAGAAAGG + Intergenic
980032350 4:127845446-127845468 ATGCATATTAAGAGATAAAATGG - Intergenic
980116640 4:128685830-128685852 ATGTACACTAAGAGGCAAAATGG - Intergenic
980252497 4:130335777-130335799 ATGAGCATTAAGAGGCAAAATGG + Intergenic
980270999 4:130583449-130583471 ATGCACACCAAGAGACAGAATGG - Intergenic
980416605 4:132496585-132496607 ATGCACACTAAGAGGCAAAAGGG - Intergenic
980810758 4:137876063-137876085 ATGCACATTAAGAGGCAAAATGG - Intergenic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
981432155 4:144673539-144673561 ATGCACATTTAAAGGGAGAAAGG + Intronic
981452069 4:144910198-144910220 ATGCATATAAAAAGGTAAAAAGG - Intergenic
981526411 4:145710585-145710607 GTGCACATTAAGAGGCAAAATGG - Intronic
982439893 4:155423036-155423058 ATGCACATTAAGAGGCAAAATGG - Intergenic
982643984 4:157999009-157999031 ATGGGTATTGAGAGGCAGACAGG + Intergenic
982669445 4:158302566-158302588 ATGCATATTGAAAGGCAGGGTGG - Intergenic
982921921 4:161286503-161286525 GTGAATATTAAGAGAAAGAAAGG - Intergenic
982922641 4:161294508-161294530 ATGCACACTAAGAGGCACAATGG + Intergenic
982988819 4:162244663-162244685 ATGCATACTCTGAGGCAAAATGG + Intergenic
983038729 4:162899007-162899029 ATGCACATTAAGAAGCAAAATGG - Intergenic
983067375 4:163227102-163227124 ATGCACACTAAGATGCAAAATGG + Intergenic
983262304 4:165470472-165470494 AAGCATACTAAGAGGCAAAATGG - Intronic
983406344 4:167335804-167335826 GTGCACATTAAGAGGCAAAATGG - Intergenic
983830585 4:172321971-172321993 ATGCACACAAAGAGGCAAAATGG + Intronic
983898731 4:173110006-173110028 ATTTATATTAAGAGAAAGAAGGG - Intergenic
984113031 4:175643805-175643827 CTGCACACTAAGAGGCAAAATGG + Intronic
984422790 4:179546523-179546545 ATGCCCATGAAGAGGCAAAATGG + Intergenic
984436520 4:179717319-179717341 ATGCACACTAAAAGGCAAAATGG + Intergenic
985230841 4:187814819-187814841 ATGCGCATTAAGAGGCAAAATGG + Intergenic
986178632 5:5373247-5373269 TTGCACATCAAGAGGCAAAATGG - Intergenic
986275437 5:6271098-6271120 ATGCACCCTAAGAGGCAAAATGG - Intergenic
986326149 5:6676192-6676214 ATGCACAGTAAGGGGCAAAATGG + Intergenic
986476879 5:8143334-8143356 ATGCTCATTAAGAGACAAAATGG - Intergenic
986685033 5:10269058-10269080 ATGCGCATTAAGAGGCAAAATGG - Intergenic
986710606 5:10485792-10485814 ATGCAGATTCTGATGCAGAAGGG + Intergenic
987100629 5:14588515-14588537 ATACATATTAAAAGTCAGAAGGG + Intronic
987488019 5:18544406-18544428 ATGCTCATTAAGAGACAAAATGG + Intergenic
987878442 5:23710993-23711015 ATGCGCGTTAAGAGGCAAAATGG - Intergenic
988131207 5:27108607-27108629 ATGCACATTAAAATGCAAAATGG - Intronic
988242567 5:28632801-28632823 ATGCGCATTAAGAGACAAAATGG + Intergenic
988629630 5:32914931-32914953 ATGAACATTAAAAGGCAAAATGG + Intergenic
988737675 5:34039041-34039063 ATGTGCATTAAGAGGCAAAATGG + Intronic
988882160 5:35515533-35515555 ATGTGCATTAAGAGGCAAAATGG + Intergenic
988915608 5:35891088-35891110 ATGCACAGTAAGAGACAAAATGG + Intergenic
988961459 5:36375487-36375509 CTGTAAATTGAGAGGCAGAAAGG - Intergenic
989187446 5:38638784-38638806 ATGCGCATTAAGAGACAAAATGG - Intergenic
989306977 5:39969391-39969413 ATGCATGTTAAGAGACAAAATGG + Intergenic
989343317 5:40401603-40401625 ATGCGTATTAAGGGACACAAGGG - Intergenic
989558319 5:42822537-42822559 ATGCATATTAATAGGAGAAAAGG - Intronic
989614999 5:43330415-43330437 AAGCATATTAAGATCAAGAATGG + Intergenic
990018624 5:51098324-51098346 ATGCACATTAAGAGGCAAAATGG - Intergenic
990421021 5:55633306-55633328 AGGCAGATTAATAGGCAAAAAGG - Intronic
990444515 5:55881665-55881687 ATGGCCATTAAGAGGCAAAATGG - Intronic
990597924 5:57329868-57329890 ATGAAGATGAAGAGGCAAAAAGG - Intergenic
990777217 5:59315694-59315716 ATGCACAGTAAGGGGCAAAATGG + Intronic
991030498 5:62077468-62077490 ATGCACACTAAGAGGCAAAATGG + Intergenic
991311604 5:65249266-65249288 ATGCACATTAAGAGACAAAATGG + Intronic
991657662 5:68920280-68920302 ATGCGCATTAAGAGGCAAAATGG - Intergenic
991929937 5:71744325-71744347 ATGCGCACTAAGAGGCAAAATGG + Intergenic
992898157 5:81265327-81265349 ATGCATATAAAGAGATAGATAGG + Intronic
993184318 5:84597428-84597450 ATGCATATTTATAGCCAGATAGG - Intergenic
993269763 5:85780147-85780169 ATAAATAATAAGAGGTAGAATGG + Intergenic
995153151 5:108875391-108875413 ATGCAAAAAAAGAGGCAGATGGG - Intronic
995594663 5:113734920-113734942 ATGCACATTAAGAGACAAAGTGG + Intergenic
995966316 5:117911615-117911637 ATGCACACTAAGAGGCAAAATGG + Intergenic
996906807 5:128610267-128610289 ATGAGCATTAAGAGGCAAAATGG - Intronic
997036546 5:130199331-130199353 ATTCCTATTGAGAGGTAGAATGG - Intergenic
997436359 5:133878503-133878525 ATGCACACTAAGAGGCAAAATGG + Intergenic
998074712 5:139226144-139226166 ATGCAGTTTAAGAGGCAAAATGG - Intronic
998169142 5:139862015-139862037 CAGCAAATTAGGAGGCAGAAGGG + Intronic
999518465 5:152324659-152324681 ATGCACACTAAGAGGCAAAATGG - Intergenic
999629300 5:153553695-153553717 ATGCACACTAAGAGGCAAAATGG - Intronic
1000675005 5:164110596-164110618 ATTCAGACTAAGAGGAAGAATGG + Intergenic
1000766619 5:165299521-165299543 ATGCACACTAAGAGGCAAAATGG - Intergenic
1001914269 5:175546711-175546733 ATGCACACTAAGAGGCAACATGG - Intergenic
1002802756 6:541356-541378 GTTCATATTAAAAGACAGAAAGG + Intronic
1002970257 6:2009523-2009545 ATGCTTTTTAAAAGGCAGGAGGG + Intronic
1003076076 6:2984862-2984884 ATGCAAATTAAGAGCCAGGTGGG + Intergenic
1003196442 6:3919270-3919292 ATGCACATTAAGAAACAAAATGG - Intergenic
1003201993 6:3969842-3969864 ATGCACACTAAAAGGCAAAATGG - Intergenic
1003362376 6:5440543-5440565 ATGCATATTCATAGGCACACTGG + Intronic
1003466029 6:6380874-6380896 ATGCATGTGAAGAGAGAGAAGGG + Intergenic
1003958058 6:11184218-11184240 GTGAATATTAAGAGTCAGAAAGG + Exonic
1004291835 6:14374522-14374544 ATGCACCCTAAGAGGCAAAATGG - Intergenic
1004467703 6:15901355-15901377 ATGCACACTAAGAGGCAAAGTGG - Intergenic
1004474278 6:15956712-15956734 ATGCACACTAAGAGGCAAAATGG - Intergenic
1004832515 6:19492539-19492561 ATGCATTGCAAGAGGCAAAAGGG + Intergenic
1005106463 6:22229369-22229391 ATGCGTGTTAAGAGACAAAATGG - Intergenic
1005250163 6:23936419-23936441 ATGCATAGCTAGAGGCAAAATGG - Intergenic
1006679238 6:35785501-35785523 ATGCACATTAAGAGAAAAAATGG - Intronic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007362010 6:41365034-41365056 ATCCCTATTAAGAGGATGAAAGG + Intergenic
1007832223 6:44647331-44647353 TTATAAATTAAGAGGCAGAAAGG - Intergenic
1009323473 6:62319937-62319959 AGGAATAATAAGAGGCAGATTGG + Intergenic
1009657954 6:66569906-66569928 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1010913765 6:81590326-81590348 ATGCACACTAAGAGGCAAAATGG + Intronic
1010977252 6:82329697-82329719 ATGCACATTAAGAGGCAAAATGG + Intergenic
1011458181 6:87575125-87575147 ATACAGATTATGAAGCAGAATGG + Intronic
1011837410 6:91450496-91450518 ATGCATGTGAAGGGGTAGAAAGG - Intergenic
1012126377 6:95433679-95433701 AGGAATATTGAGAGGCAGAAAGG - Intergenic
1012140095 6:95616116-95616138 ATCCATAGTCAAAGGCAGAAAGG - Intergenic
1012716139 6:102673004-102673026 ATCCATACTAAGAGCCAAAATGG - Intergenic
1012779370 6:103537048-103537070 ATGCACACTAAAAGGCAAAATGG - Intergenic
1012928813 6:105295459-105295481 ATGTAGCTTAAGAGGCAGACAGG - Intronic
1013528604 6:110998353-110998375 ATGCACACTAGGAGGCAAAATGG - Intronic
1013684672 6:112565586-112565608 ATGCACATTAAGAGGCAAAATGG - Intergenic
1013866795 6:114708244-114708266 ATGCACACTAAGAGGCAAAGTGG + Intergenic
1014524951 6:122491339-122491361 ATGCACATTAAGAGGCAAAATGG - Intronic
1015550371 6:134405857-134405879 CTGCATATTTAAAGCCAGAAAGG - Intergenic
1015824909 6:137301174-137301196 ATGCACGTTAAGAGGAAAAATGG - Intergenic
1016126663 6:140412072-140412094 ATGCACATTAAGAGCCAAAATGG + Intergenic
1016363268 6:143290542-143290564 ATGCACACTAAGAGGAAAAATGG - Intronic
1016486021 6:144540625-144540647 ATGTATATTAAGGCACAGAAGGG - Intronic
1017408243 6:154142369-154142391 ATGCACATTAAGAGGCAAAATGG + Intronic
1018845886 6:167555160-167555182 ATGCACACTAAGAGGCAAAATGG - Intergenic
1019911301 7:4101979-4102001 TTGGATCTTCAGAGGCAGAAGGG - Intronic
1020576710 7:9941439-9941461 ATACATATTAAGAGTTAAAAAGG + Intergenic
1020680887 7:11235069-11235091 ATGCACATTAAGAGACAAAATGG - Intergenic
1020764424 7:12302663-12302685 ATCCACACTAAGAGGCAAAATGG + Intergenic
1021601617 7:22369924-22369946 ATGCAAACTCAAAGGCAGAAAGG - Intergenic
1021688987 7:23214111-23214133 ATGCCCACTAAGAGGCAAAATGG - Intergenic
1022321389 7:29291178-29291200 ATGCGCACTAAGAGGCAAAATGG - Intronic
1022807008 7:33832365-33832387 AAGCAAAGTAATAGGCAGAAGGG - Intergenic
1022988980 7:35688771-35688793 ATGTATAATAAGATGAAGAAAGG - Intronic
1023096296 7:36662973-36662995 ATGCATAAGAAGTGGCAGTATGG + Intronic
1023392084 7:39720446-39720468 ATGCACACTAAGGGGCAAAATGG - Intergenic
1024193987 7:47040864-47040886 ATGTGCATTAAGAGGCAGAATGG + Intergenic
1024430433 7:49282322-49282344 ATGCAGACTAAGAGGCAAACTGG + Intergenic
1026130495 7:67616711-67616733 ATGCGCATTAAGAGGCAAAATGG + Intergenic
1026258259 7:68731717-68731739 ATGCATATTAAGAGGCAAAATGG + Intergenic
1026274479 7:68864622-68864644 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1026322502 7:69279902-69279924 ATGCACCCTAAGAGGCAAAATGG - Intergenic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1027465421 7:78508828-78508850 ATGCATCTTAAAAGTCAAAAAGG - Intronic
1027596836 7:80184544-80184566 ATGCACATTAAGAGGCAAAATGG - Intronic
1027616514 7:80430935-80430957 ACACACATTAAGAGGCAAAATGG + Intronic
1027993332 7:85392784-85392806 ATGCATGCTAGGAGGCAAAATGG - Intergenic
1028360813 7:89964375-89964397 ATGCACGTTAAGAGACAAAATGG + Intergenic
1028392530 7:90333801-90333823 ATGCACATTAAGACACAAAATGG + Intergenic
1028794205 7:94885790-94885812 ATGCACATTAAGAGGCAAAATGG - Intergenic
1028833827 7:95352246-95352268 ATGCATACTAAGAGGCAAAATGG + Intergenic
1029106846 7:98184252-98184274 AGGCACACTAAGAGGCAAAATGG - Intronic
1029330487 7:99849676-99849698 ATACATATTAAGAGTAAAAAGGG - Exonic
1030164160 7:106536203-106536225 ATGGATATTTAGAGGTGGAAGGG - Intergenic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030515510 7:110533443-110533465 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1030646980 7:112072803-112072825 ATGCACACTAAGAGGTAAAATGG + Intronic
1030825794 7:114156089-114156111 ATGTGCATTAAGAGGCAAAATGG - Intronic
1031090852 7:117351759-117351781 ATGCATATTAAAAGACAAAATGG - Intergenic
1031347482 7:120686815-120686837 ATGTGTACTAAGAGGCAAAATGG - Intronic
1031637256 7:124116916-124116938 ATGCACACTAAAAGGCAAAATGG - Intergenic
1031639558 7:124145058-124145080 ATGCACAATAAAAGGCAAAATGG - Intergenic
1031644338 7:124204826-124204848 ATGCATATTTAGAGTCAAGAAGG + Intergenic
1031670435 7:124536473-124536495 ATGAATTTTAAGAGACAAAAAGG + Intergenic
1031928328 7:127659621-127659643 ATGTATATCAAGAGGAATAAAGG + Intronic
1033022063 7:137735521-137735543 ATGCATATGATGAGGTAGACGGG + Intronic
1033446601 7:141428479-141428501 ATTCATACTAAGAGGCAAAATGG + Intronic
1034083491 7:148302300-148302322 ATGTACATTAAGACCCAGAAGGG + Intronic
1034237071 7:149580271-149580293 ATGAATAAGAAGAGGCAGAGTGG - Intergenic
1034240146 7:149604075-149604097 ATGAATAAGAAGAGGCAGAGTGG - Intergenic
1036164632 8:6421158-6421180 ATGCACATTAAGAGACAAAATGG - Intronic
1037135383 8:15453954-15453976 ATGTACACTAAGAGGCAAAATGG + Intronic
1037586236 8:20278230-20278252 ATGCGCACTAAGAGGCAAAATGG + Intronic
1038100770 8:24371872-24371894 ATACATATTAATAGGAATAATGG + Intergenic
1038113572 8:24527532-24527554 ATGCATTTTAATAAGCATAATGG - Intergenic
1038119674 8:24598919-24598941 AAGAAGTTTAAGAGGCAGAAGGG + Intergenic
1039005058 8:33026954-33026976 ATGCACATTAAGAGGCAAAATGG - Intergenic
1039106083 8:33991323-33991345 ATGTATATTAAGTGGCAAAAAGG - Intergenic
1039637558 8:39182628-39182650 ATGGATATTTAAAGACAGAAAGG - Intronic
1039959286 8:42233404-42233426 ATGCACATTAAGAGGCAAAATGG - Intergenic
1041100593 8:54392748-54392770 ATGCAGAGAAGGAGGCAGAAGGG + Intergenic
1041207756 8:55515526-55515548 ATGAATATCCAGAGCCAGAATGG - Intronic
1041386104 8:57304980-57305002 ATGCACATTAAGAGGCAAAATGG - Intergenic
1041386204 8:57306211-57306233 ATGCACACTAAGGGGCAAAATGG - Intergenic
1041393831 8:57372367-57372389 ATGCACACTAAGAGGAAAAATGG + Intergenic
1041409780 8:57540839-57540861 ATGCACACTAAAAGGCAAAATGG - Intergenic
1041442008 8:57907311-57907333 ATGGAAATTAAGAGGAAGAAAGG + Intergenic
1041547967 8:59067790-59067812 ATGCAAATTAATAGGTAAAATGG - Intronic
1041924800 8:63225480-63225502 AAGCATAATAAAAGGCAGTATGG - Intergenic
1042311159 8:67380570-67380592 ATGCACATTAAGAGGCAAAATGG + Intergenic
1042343975 8:67709050-67709072 ATGCACGCTAAGAGGCAAAATGG + Intronic
1042369378 8:67973441-67973463 ATACATAAGTAGAGGCAGAAAGG - Intronic
1042397108 8:68305719-68305741 ATGCACATTAAGAGGCATAATGG + Intronic
1042667398 8:71221798-71221820 ATGCACATTAAGAGACCTAATGG + Intronic
1042747726 8:72125660-72125682 ATCCACACTAAGAGGCAAAATGG + Intergenic
1042917343 8:73888669-73888691 ATGCACACTAAGAGGCAAAATGG + Intergenic
1043794483 8:84519333-84519355 ATTCATATTAAGAGAGAGGATGG - Intronic
1043884925 8:85588092-85588114 ATGCACCTTAAGAGACAAAATGG + Intergenic
1044362952 8:91309967-91309989 ATGCATATTCAGAGGCAAAATGG - Intronic
1044363056 8:91310612-91310634 ACGCGTATTAAGGGGCAAAATGG + Intronic
1044423832 8:92028490-92028512 ATGGATATTAAGTGGCAGCCTGG + Intronic
1044712145 8:95068220-95068242 ATGCATAAGAAGATGCTGAAAGG - Intronic
1045646554 8:104305257-104305279 ATGCAGATTAAGAGGAAAAATGG - Intergenic
1046028213 8:108750631-108750653 ATACACATTAAGAGACAAAATGG + Intronic
1046217197 8:111163967-111163989 ATGCACACTAAGAGGCAAAATGG - Intergenic
1046386890 8:113517747-113517769 ATGCACACTAAGAGGCAAAATGG + Intergenic
1046512996 8:115222265-115222287 ATGCACACCAAGAGGCAAAATGG + Intergenic
1046615099 8:116468235-116468257 ATGACTACTAAGTGGCAGAATGG - Intergenic
1046699713 8:117386388-117386410 ATGCTTATTAACAAGGAGAAGGG - Intergenic
1047871791 8:129091264-129091286 ATGCACACTAAGAGGCAAAATGG - Intergenic
1048128369 8:131663145-131663167 ATGCACATCAAGAGACAAAATGG + Intergenic
1048415368 8:134222418-134222440 ATGCATATGAAGCGGTATAATGG + Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048431897 8:134378322-134378344 ATGCGTATTAAGAGGCAAAATGG + Intergenic
1048461937 8:134628224-134628246 AAGCATATTCAGAGGTAAAAGGG + Intronic
1050042927 9:1514604-1514626 ATGCACACTAAGAGGCAACATGG - Intergenic
1050636612 9:7619354-7619376 ATGCAAATTAAGAGGCAAAATGG + Intergenic
1050815514 9:9806775-9806797 ATGCACACTAAGAGGCAAAATGG + Intronic
1051480344 9:17553513-17553535 AACCATATTAAGAGACAAAAAGG - Intergenic
1051598828 9:18851842-18851864 ATGTACACTAAGAGGCAAAATGG - Intronic
1051744664 9:20283952-20283974 ACGCATGTTAAGAGACAAAATGG - Intergenic
1051991213 9:23154467-23154489 ATGCGCATTAAGAGGCAAAATGG + Intergenic
1052140472 9:24975662-24975684 ATGCCTATTATGAGGGACAAGGG + Intergenic
1052160717 9:25255336-25255358 ATGTGCACTAAGAGGCAGAATGG + Intergenic
1052362682 9:27577003-27577025 ATGCACATTAAGAGGCAAAATGG - Intergenic
1053336289 9:37275518-37275540 ATGCATATTAAGAGAAACACTGG - Intronic
1053825802 9:42023031-42023053 ATGCGCACTAAGAGGCAAAATGG + Intronic
1054604761 9:67164362-67164384 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1054899248 9:70350638-70350660 ATGCTTAATCAGAGGAAGAAAGG + Intronic
1055005659 9:71503196-71503218 ATGTATATTAATAGGCAAAAAGG + Intergenic
1055058698 9:72047061-72047083 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1055265685 9:74493585-74493607 ATTCATATTCAGTGGCTGAAAGG + Intergenic
1055763784 9:79639072-79639094 AACCATATTAAAATGCAGAAGGG - Intronic
1056094544 9:83239217-83239239 ATGCACAATAAGAGACAAAATGG + Intergenic
1056435222 9:86569419-86569441 ATGCACATTAAGAAGCAAAATGG - Intergenic
1056739708 9:89243857-89243879 ATGTACAATAAGAGGCAAAATGG - Intergenic
1058130183 9:101243071-101243093 AAGCATATTAATAGGCACAGAGG + Intronic
1058143384 9:101382283-101382305 ATGCACATTAAGAGTCAAAATGG + Intronic
1059479824 9:114580473-114580495 ATTCACACTAAGAGGCAAAATGG + Intergenic
1060954595 9:127629509-127629531 AGGCATCTTAGGATGCAGAAGGG + Intronic
1061367486 9:130179844-130179866 AGGCAAATTAAGCGCCAGAAAGG + Intronic
1061554920 9:131361563-131361585 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1061597183 9:131638906-131638928 TTGCTTATTAAAAGGCAGTATGG - Intronic
1062182044 9:135196143-135196165 GGGCACATTAAGAGCCAGAACGG - Intergenic
1203528310 Un_GL000213v1:110893-110915 ATGCATATTAAGAAGAAAACTGG + Intergenic
1185886698 X:3789622-3789644 ACGCACACTAAGAGGCAAAATGG + Intergenic
1186057441 X:5665006-5665028 ATCCACATTAAGAGGCAGAATGG - Intergenic
1186569187 X:10696160-10696182 ATGCACACTAAGAGGAAAAATGG + Intronic
1186570713 X:10712344-10712366 ATGTACAATAAGAGGCAAAATGG + Intronic
1187021616 X:15388359-15388381 CAGCATGGTAAGAGGCAGAAGGG + Intronic
1187565043 X:20441175-20441197 TTGCATTTTAAAAGGCTGAAAGG + Intergenic
1188021591 X:25164469-25164491 ATGCATAGTGTGAGGAAGAAAGG - Intergenic
1188284527 X:28311876-28311898 ATGCACATTAAGAGGCAAAATGG - Intergenic
1188752836 X:33924602-33924624 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1188905551 X:35787065-35787087 ATGCGCATTAAGAGACAAAATGG + Intergenic
1188953648 X:36407817-36407839 ATGCACACTAAGAGGCAAAATGG + Intergenic
1190138505 X:47819173-47819195 ATGCACAGTAAGGGGCAAAATGG + Intergenic
1190704301 X:53013675-53013697 ATGCACACTAAGAGGCAAAATGG - Intergenic
1191607382 X:63077618-63077640 ACGCATATTAGGAGGCAAAATGG + Intergenic
1193485339 X:82079823-82079845 ATGCACATTAAGAGAGAGAATGG + Intergenic
1193658005 X:84222249-84222271 AAGCATGATAAGAGGTAGAAGGG - Intergenic
1193731956 X:85112675-85112697 ATGCGCATTAAAAGGCAAAATGG - Intergenic
1193907996 X:87265668-87265690 ATGCGTAGTAAGGGGCAAAATGG - Intergenic
1193934635 X:87601506-87601528 ATGCACACTAAGAGACAAAATGG - Intronic
1193974698 X:88102863-88102885 ATGCGCATTAAGAGGCAAAATGG - Intergenic
1194010927 X:88559926-88559948 ATGCGCATTAAGAGACAAAATGG - Intergenic
1194041030 X:88942175-88942197 ATGAATCTTCAGAGGCAAAAAGG - Intergenic
1194089540 X:89567729-89567751 ATGTACATTAAGAGACAAAATGG - Intergenic
1194161969 X:90465015-90465037 ATGCACATTAAGAGGCAAAATGG - Intergenic
1194302187 X:92202323-92202345 ATGTACAGTAAGAGGCAAAATGG - Intronic
1194553097 X:95325188-95325210 ATGCACATTAAGAGGCAGAATGG - Intergenic
1194627643 X:96244040-96244062 ATGCACACTAAGAGGCAAAATGG - Intergenic
1194648115 X:96482951-96482973 ATGTACATTAAGAGACAAAATGG - Intergenic
1194692218 X:97001051-97001073 ATGCATATTAAGAAAATGAAAGG - Intronic
1194810570 X:98382628-98382650 ATGCACATTATGAGGCAAAATGG + Intergenic
1194850710 X:98865196-98865218 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1194980759 X:100438040-100438062 ATGCACATTAAGAGGCAAAATGG + Intergenic
1195256840 X:103099228-103099250 ATGCACATTAAGAGACAAAAAGG - Intergenic
1195814129 X:108867140-108867162 TTGCAGATTCATAGGCAGAAGGG - Intergenic
1196223091 X:113135179-113135201 ATGCTTACTAAGAGGAAAAATGG - Intergenic
1196293749 X:113976299-113976321 AGGCATATTAATAGGAAGGAAGG - Intergenic
1196366075 X:114925842-114925864 ATGCCCATTAAGAGGCAAAATGG + Intergenic
1196709447 X:118747457-118747479 ATCCATTTTATGAGGAAGAAAGG + Intronic
1197470431 X:126861604-126861626 ATGCACACTAAGAGACAAAATGG + Intergenic
1197660745 X:129168695-129168717 ATGCACATTAAGAGGCCAACTGG + Intergenic
1197932209 X:131707580-131707602 CTTCACATTAAGAGGCAAAATGG + Intergenic
1197938063 X:131761073-131761095 ATGCGTATTAAGACACAAAATGG + Intergenic
1197939683 X:131776849-131776871 ATGCGTATTAAGACACAAAATGG + Intergenic
1199009301 X:142740144-142740166 ATGCAAATTAAGAGACAAAATGG + Intergenic
1199082446 X:143591894-143591916 TTGCGCATTAAGAGGCAAAATGG - Intergenic
1199276171 X:145944958-145944980 ATGCACATTAAGAGGCAAAATGG - Intergenic
1199322917 X:146462533-146462555 ATGCACACTAAGAGACAAAATGG - Intergenic
1199347358 X:146757292-146757314 ATACACATTAAGAGGCAACATGG - Intergenic
1199381462 X:147177435-147177457 ATGCATATTAAGAGACAAAAAGG + Intergenic
1200508250 Y:4042760-4042782 ATGCACATTAAGAGGCAAAATGG - Intergenic
1200775571 Y:7167305-7167327 ATGCACACTGAGAGGCAAAATGG - Intergenic
1201853658 Y:18516976-18516998 ATGCACATTAAGAGACGAAATGG + Intergenic
1201879663 Y:18803408-18803430 ATGCACATTAAGAGACGAAATGG - Intronic
1202173873 Y:22079716-22079738 GTGCACATTAAGAGACAAAATGG - Intronic
1202217487 Y:22506666-22506688 GTGCACATTAAGAGACAAAATGG + Intronic
1202274171 Y:23098558-23098580 ATGCACACTAAGAGGCAAAATGG + Intergenic
1202291855 Y:23322119-23322141 ATGCACACTAAGAGGCAAAATGG - Intergenic
1202325699 Y:23689393-23689415 GTGCACATTAAGAGACAAAATGG - Intergenic
1202427167 Y:24732303-24732325 ATGCACACTAAGAGGCAAAATGG + Intergenic
1202443624 Y:24937791-24937813 ATGCACACTAAGAGGCAAAATGG - Intergenic
1202545072 Y:25980661-25980683 GTGCACATTAAGAGACAAAATGG + Intergenic