ID: 953508940

View in Genome Browser
Species Human (GRCh38)
Location 3:43515824-43515846
Sequence AAGGAAACCTTGCCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953508940_953508943 14 Left 953508940 3:43515824-43515846 CCAGCCTGGGGCAAGGTTTCCTT 0: 1
1: 0
2: 2
3: 18
4: 256
Right 953508943 3:43515861-43515883 TACCCTGACTATCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953508940 Original CRISPR AAGGAAACCTTGCCCCAGGC TGG (reversed) Intronic