ID: 953511638

View in Genome Browser
Species Human (GRCh38)
Location 3:43546924-43546946
Sequence TGCTCAGCTTCTTAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 2, 2: 15, 3: 85, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953511638_953511643 17 Left 953511638 3:43546924-43546946 CCACAGATCTAAGAAGCTGAGCA 0: 1
1: 2
2: 15
3: 85
4: 385
Right 953511643 3:43546964-43546986 ACTCCCAAAAAGCTACACTAAGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953511638 Original CRISPR TGCTCAGCTTCTTAGATCTG TGG (reversed) Intronic
900481183 1:2900142-2900164 AGCTCAGGGTCCTAGATCTGAGG + Intergenic
900491931 1:2954222-2954244 TGTAGAACTTCTTAGATCTGTGG - Intergenic
900811754 1:4807807-4807829 TGTTTGGCTTCTTAGATCTTTGG - Intergenic
902829399 1:19000908-19000930 TGTTGAGCTTCTGGGATCTGTGG - Intergenic
904316229 1:29666281-29666303 TGTTGAGCTTCTTGGATCTATGG - Intergenic
904437844 1:30510795-30510817 GGCTCAGCCTCTTAGCTTTGTGG - Intergenic
904477157 1:30772767-30772789 TGCTCAGCTGCCCAGATGTGGGG - Intergenic
904759637 1:32793286-32793308 TGCTGAGCTTCTTGAATCAGTGG - Intronic
904979634 1:34487044-34487066 TGCAGAGCTTCTTGGATCTCTGG - Intergenic
905022268 1:34825968-34825990 TGCTGTGCTTCTGAGGTCTGTGG - Intronic
905753395 1:40486256-40486278 TGCTGAGCTTCTTGGATCTGTGG + Intronic
905964870 1:42083751-42083773 CTCTGAGCTTCCTAGATCTGTGG + Intergenic
906608708 1:47187955-47187977 TGCTCAGCTGGGGAGATCTGGGG + Intronic
907685441 1:56607083-56607105 TGTTGAACTTCTTGGATCTGTGG - Intronic
908738360 1:67300748-67300770 TATTGAGCTTCTTGGATCTGTGG - Intergenic
908799398 1:67864003-67864025 TGCTCTGCTTCCTGGATCTTTGG + Intergenic
909240271 1:73204579-73204601 TGCTCATCTACTTAAATCTATGG - Intergenic
910470308 1:87546327-87546349 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
911250133 1:95567097-95567119 TGTTGAGCTACTTGGATCTGTGG + Intergenic
911343879 1:96673703-96673725 TGCTCAGCTGCCTAGAGCAGGGG + Intergenic
911465482 1:98247559-98247581 TGCTGAGATTATTACATCTGTGG + Intergenic
912085995 1:106004963-106004985 TGTTGAGCTTCTCAGATCTGTGG - Intergenic
912116263 1:106412408-106412430 TGCCCAGCATCTGAGATGTGGGG + Intergenic
912119381 1:106451778-106451800 TGCTCAGATTCTTATTTCAGTGG - Intergenic
912399317 1:109375603-109375625 TTCTGAGCTTCTTGGATCTCTGG - Intronic
912899159 1:113629817-113629839 TGCTGAGCCTCTTGGAACTGGGG + Intronic
913312699 1:117517785-117517807 TGTTTAGCTTCTTGGACCTGTGG - Intronic
913321505 1:117591769-117591791 TCCTCAGCTTACTAGCTCTGAGG + Intergenic
913396113 1:118374676-118374698 TGCTCTGCCGCTGAGATCTGTGG + Intergenic
914509277 1:148317269-148317291 TCCCCACCTTCTTAGGTCTGAGG - Intergenic
916321931 1:163513615-163513637 TTCTGAGCTGCTTGGATCTGAGG - Intergenic
916508073 1:165445864-165445886 TGCTTAGATTCTTTGATCTCGGG - Intergenic
916769034 1:167890426-167890448 TGCTGAGCTGCTTGGAGCTGGGG + Intronic
917034583 1:170733757-170733779 TTCTCAGATACTTAGATCTTCGG + Intronic
917173402 1:172202708-172202730 TGTTCTTCTTCTTATATCTGTGG - Intronic
917306380 1:173628909-173628931 TGCTGAGCTGCCTAGAACTGGGG - Intronic
917544717 1:175951920-175951942 TGTTAAGCTTCTTAGATTTGTGG - Intronic
917563784 1:176189009-176189031 TTCTGAGTTTCTTAGATCTGTGG - Intronic
917698439 1:177554871-177554893 TATTGAGCTTCTTGGATCTGTGG - Intergenic
917734646 1:177909330-177909352 AGTTCAGCTTCTGAGATGTGAGG - Intergenic
918352172 1:183668712-183668734 CTCTGAGCTTCCTAGATCTGTGG + Intronic
919284143 1:195531871-195531893 TGCTCAGCATCATTAATCTGTGG + Intergenic
919806530 1:201384001-201384023 TGCTCAGCCTGTGAGAGCTGGGG - Intronic
919836478 1:201577995-201578017 TGCTCAGATTCTTGAATCTGTGG + Intergenic
920570767 1:207015646-207015668 TGTTCAGTTGCTTGGATCTGAGG - Intronic
920731577 1:208490655-208490677 TGCTGAGCTTCTTAGATCTGTGG + Intergenic
921074782 1:211691595-211691617 TGCTAAGGCCCTTAGATCTGGGG - Intergenic
921823236 1:219641213-219641235 TGCTGAGCTGCCTAGAGCTGGGG - Intergenic
923624674 1:235604353-235604375 GTCTCAGCTTCCTAGAGCTGTGG + Intronic
923893141 1:238237723-238237745 TTCTGAGCTTCTTGAATCTGTGG - Intergenic
924252759 1:242151667-242151689 TTCTGAGCTTCTTGGATCTATGG + Intronic
924364985 1:243283283-243283305 CGGTGAGCTTCCTAGATCTGTGG + Intronic
1062845585 10:701747-701769 TGCTGGGCTTCTGTGATCTGTGG + Intergenic
1063431409 10:5992454-5992476 ATCTGAGCTTCTTGGATCTGTGG - Intergenic
1065431729 10:25665058-25665080 TGTTGAGCTTCTTAAATCTGTGG + Intergenic
1065572033 10:27080968-27080990 TGCTGAACTACATAGATCTGTGG - Intronic
1065647572 10:27851809-27851831 TGCTAAGCTTCTGAGATCTGTGG - Intronic
1067241521 10:44499096-44499118 CACTCAGCTTCTTAAATCTGTGG - Intergenic
1067368590 10:45660546-45660568 CTCTGAGCTTCTTGGATCTGTGG - Intronic
1067664300 10:48261274-48261296 TTCCAAGCTTCCTAGATCTGTGG - Intronic
1068403081 10:56555365-56555387 TGCTTTGCTTATTAGACCTGTGG - Intergenic
1068685074 10:59861944-59861966 TTCTGAGCTTCTTGGATCTGTGG - Intronic
1069599571 10:69694752-69694774 TGTTCTGATTCTAAGATCTGGGG + Intergenic
1069966345 10:72120548-72120570 CTCTGAGCTTCCTAGATCTGTGG - Intronic
1071018663 10:81027534-81027556 TGCTCAGCATCCCAGGTCTGGGG - Intergenic
1071063733 10:81605749-81605771 TGTTAGGCTTCTTAGATCTCGGG + Intergenic
1071199183 10:83198998-83199020 CTCTGAGCTTCTTGGATCTGTGG + Intergenic
1071252248 10:83831088-83831110 CACTCAGCTTCTTGGATTTGTGG - Intergenic
1072120161 10:92399070-92399092 CTCTGAGCTTCCTAGATCTGTGG - Intergenic
1073008229 10:100340608-100340630 TGCTCAGCATGTTTGTTCTGTGG + Intergenic
1074343941 10:112662158-112662180 TGTTAAACTTCTTTGATCTGTGG + Intronic
1074691854 10:116013096-116013118 TCCTGAGCATCTTGGATCTGTGG + Intergenic
1075830475 10:125406942-125406964 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
1076805508 10:132856336-132856358 CATTCAGCTTCTTGGATCTGTGG + Intronic
1077995673 11:7450143-7450165 GCCTCAGCTTCTTTTATCTGGGG - Intronic
1078275612 11:9842477-9842499 TTACCAGCTTCTTAGAACTGGGG - Intronic
1079108513 11:17589841-17589863 TCCTCACCTTCCTAGACCTGTGG + Intronic
1079619912 11:22541305-22541327 TTCTCAGATTCTTAAATCTGGGG - Intergenic
1079716494 11:23754409-23754431 CATTGAGCTTCTTAGATCTGTGG + Intergenic
1080301534 11:30790425-30790447 TACTCAGTTTCATAGATGTGGGG + Intergenic
1080732639 11:34975257-34975279 CTCTCAGCTTCTTAGATGTATGG + Intronic
1080738768 11:35043904-35043926 TGCTCTGCTTATTAGCTGTGTGG - Intergenic
1080994868 11:37587162-37587184 TGTTGAGTTTCTTAGATCTGTGG + Intergenic
1081419144 11:42851911-42851933 TATTGAGCTTCTTGGATCTGTGG - Intergenic
1081496348 11:43614546-43614568 TTGTAAGTTTCTTAGATCTGTGG + Intronic
1082077737 11:47987416-47987438 TGATCAGTTTCTTAAGTCTGGGG + Intronic
1085147441 11:74213608-74213630 TGCTGAGCTTCCTGGAGCTGGGG - Intronic
1085442012 11:76573807-76573829 CTCTTAGCTTCTTGGATCTGTGG + Intergenic
1085640578 11:78190093-78190115 TGCTCAGCACCTAAGAGCTGAGG - Intronic
1085653637 11:78291921-78291943 TACTCAGATTCTTAGAACAGAGG + Intronic
1085685060 11:78613979-78614001 TTCTGGGCTTCTTGGATCTGTGG + Intergenic
1085694910 11:78695894-78695916 TTCTGAGCTTTTTGGATCTGTGG + Intronic
1087057660 11:93949376-93949398 TTCTCAGCTTCTAAGAACTCTGG + Intergenic
1087165488 11:94998641-94998663 AGCTGGGCTTCTTAGAGCTGTGG - Exonic
1087472870 11:98600228-98600250 TGCTGAGCTGCCTAGAGCTGGGG + Intergenic
1088181935 11:107122163-107122185 TGCTTAGCTGCTTGGAGCTGGGG - Intergenic
1088345086 11:108814929-108814951 TGCCCAGCTTGTTAGAGATGAGG + Intronic
1088702174 11:112423111-112423133 TTCTCAGCCTCGTCGATCTGAGG + Intergenic
1089465758 11:118685069-118685091 TTCTGAGCTTCCTGGATCTGTGG + Intergenic
1090319140 11:125826769-125826791 TTCTAAACTTCTTAAATCTGTGG + Intergenic
1090506941 11:127325460-127325482 TCATGAGCTTCTTGGATCTGTGG - Intergenic
1090968902 11:131622797-131622819 TGCTCAGCTTGTTAGCTCAAGGG - Intronic
1091216592 11:133906128-133906150 TGATCAGCTTCTTAGGACTTCGG - Intergenic
1091249843 11:134134354-134134376 TTCTGAGCTTCATGGATCTGTGG - Intronic
1091437881 12:487311-487333 TTCTGAGCTTCTTGGATCTGTGG - Intronic
1091445756 12:543460-543482 TGCTCATCTTCCTGGAGCTGAGG + Intronic
1091445812 12:543670-543692 TGCTCATCTTCCTGGAGCTGAGG + Intronic
1091445867 12:543880-543902 TGCTCATCTTCCTGGAGCTGAGG + Intronic
1091445911 12:544048-544070 TGCTCATCTTCCCAGAGCTGAGG + Intronic
1091445923 12:544090-544112 TGCTCATCTTCCTGGAGCTGAGG + Intronic
1091597592 12:1888857-1888879 CGCTGTGCTTCCTAGATCTGTGG - Intronic
1091876177 12:3935010-3935032 CTCTGAGCTTCTTAGATCTGTGG - Intergenic
1093150712 12:15617943-15617965 TGTTGAGCTTCTTGGAACTGTGG - Intergenic
1094001773 12:25702858-25702880 TGTTGAGCGTCTTGGATCTGTGG - Intergenic
1094067185 12:26373676-26373698 TGCTTAGCTTCTGAGATCAGAGG + Intronic
1095566214 12:43627072-43627094 TTCTGAGCTTCCTAGATCTACGG + Intergenic
1095608973 12:44104982-44105004 TTCTGAGCTTCCTGGATCTGTGG + Intronic
1095914427 12:47462158-47462180 TGTTGAGCTTCTTGGATTTGTGG - Intergenic
1096016113 12:48276785-48276807 CTCTGAGCTTCTTGGATCTGTGG + Intergenic
1096058696 12:48678022-48678044 TGCTTAGCTTCTGAGATCAGAGG - Intronic
1096586369 12:52623117-52623139 TGCTCAGCTTCCTGAATCTGTGG - Intergenic
1098444925 12:70556646-70556668 TTCTGAGCTTCCTGGATCTGTGG - Intronic
1098654843 12:73014603-73014625 TTCTCTGCTTCTTGAATCTGTGG + Intergenic
1100562235 12:95759205-95759227 TACTGAGCTTCTTAGATCTGTGG + Intronic
1100875830 12:98960258-98960280 TGCTGAGCTGCCTAGAACTGTGG - Intronic
1101168659 12:102064792-102064814 TGCTGAGCTGCTCAGATCTGTGG + Intergenic
1101621371 12:106391952-106391974 TAGTCAGCTTCTTAGAAGTGAGG - Intronic
1101634671 12:106528777-106528799 CGCCAAGCTTCTTGGATCTGTGG - Intronic
1102391031 12:112548790-112548812 TCTTCAGCTTCTTAGAGCAGTGG + Intergenic
1105435518 13:20374221-20374243 TGCTGAGCTTCTTGAATCTGTGG - Intergenic
1105726900 13:23171907-23171929 GGCTCAGCCTCTTAGATCAGAGG - Intergenic
1105755203 13:23457450-23457472 AGCTCATATTCTTAGACCTGGGG + Intergenic
1105889419 13:24671637-24671659 AGGTCAGATTCTTGGATCTGAGG - Intergenic
1106091226 13:26596645-26596667 TAATGAGCTTCTTCGATCTGTGG + Intronic
1106900245 13:34348103-34348125 TGCTCAACTTCTGAGAATTGAGG + Intergenic
1107248385 13:38325616-38325638 TTCTGAGTTTCTTAGACCTGTGG - Intergenic
1107392399 13:39980648-39980670 TGCTGAGCTTCTCAAATCTCTGG + Intergenic
1108025532 13:46173057-46173079 TGCTTTACTTCTTAGATGTGTGG + Intronic
1108504149 13:51095341-51095363 TTCTTAACTTCTTAGATCTGTGG + Intergenic
1108822890 13:54375301-54375323 TGCTTAGCTTCTTGAATATGTGG - Intergenic
1109482043 13:62968271-62968293 TGCTCAGCTTCTTAAGTATGTGG - Intergenic
1110885978 13:80636425-80636447 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
1111914350 13:94345501-94345523 TGTTCATGTTCTTAGATCTGAGG - Intronic
1113008256 13:105733020-105733042 TTTTCAGTTTCTTAGAGCTGTGG + Intergenic
1114187652 14:20415022-20415044 TGCTCAGCTTCCAAGATCAGAGG - Intergenic
1114358775 14:21946252-21946274 CTCTGAGCTTCTTAGATCTGTGG - Intergenic
1115579511 14:34744191-34744213 TGTTCACCTTCTTGAATCTGTGG + Intergenic
1115661124 14:35495045-35495067 TGCTGAGCTTCCTGGAGCTGGGG - Intergenic
1116355916 14:43929737-43929759 TTCTGAGCTTCTTGGATCTCTGG - Intergenic
1116435275 14:44888795-44888817 TGCTGATCTTCTCAAATCTGTGG + Intergenic
1116530193 14:45962228-45962250 TGTTGAGCTTCTTGGATTTGTGG + Intergenic
1117820317 14:59642322-59642344 TACTGAGCTTCTTAAATCTGTGG + Intronic
1118048571 14:62001597-62001619 TTCTAAGCTTATTAGGTCTGTGG + Intronic
1118841217 14:69514095-69514117 CTCTTAGCTTCCTAGATCTGTGG + Intronic
1119202569 14:72767790-72767812 TACTCAGCTTCTTCAACCTGTGG - Intronic
1119684307 14:76619033-76619055 TACTTAGCTTCTTGGATTTGTGG - Intergenic
1119796225 14:77399855-77399877 TCTTGAGCTTCCTAGATCTGTGG - Intronic
1120720052 14:87880941-87880963 TGCTGAGCTTCCTAGGGCTGGGG - Intronic
1120811679 14:88809885-88809907 TTCTAAACTTCTCAGATCTGTGG - Intergenic
1121167435 14:91819006-91819028 GGCGGAGGTTCTTAGATCTGTGG - Intronic
1121385012 14:93512396-93512418 TGCTGAGCTTCTCGAATCTGTGG + Intronic
1121982629 14:98468082-98468104 GGTTCACCTTCTTAGGTCTGGGG - Intergenic
1122426121 14:101606768-101606790 CTCTGAGCTTCCTAGATCTGTGG - Intergenic
1122664119 14:103316979-103317001 TGCTGAGCTTCCGAGATCAGAGG + Intergenic
1122896942 14:104762993-104763015 TGTTGAGCTTCCTGGATCTGTGG - Intronic
1122938486 14:104970679-104970701 CACTCAGCTTCTTGGAGCTGGGG + Intronic
1124968996 15:34465929-34465951 TTCTCAGCTTCTTAGAACCTTGG - Intergenic
1125524726 15:40367788-40367810 CGCTCATCTTCTTCGACCTGTGG + Exonic
1125701691 15:41691938-41691960 TACTGAGCTTCTTGGATCTGTGG + Intronic
1126272400 15:46835202-46835224 TGTTGAGCTCCTTATATCTGTGG - Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1127162910 15:56209040-56209062 CTCTGAGCTTCCTAGATCTGTGG - Intronic
1129095614 15:73204331-73204353 CTCTCAGCTTCTTGGATCTGTGG + Intronic
1129532114 15:76276451-76276473 CTCTCAGCTTCCTAGATCTGTGG + Intronic
1130249615 15:82290069-82290091 TTCTGAGCTTCCTGGATCTGTGG - Intergenic
1130450486 15:84046426-84046448 TTCTGAGCTTCCTGGATCTGTGG + Intergenic
1130451609 15:84059728-84059750 TGCTGAGCTTCTTGAATCTGTGG + Intergenic
1131440766 15:92457923-92457945 TGCCCAACCTCTCAGATCTGGGG - Intronic
1132992492 16:2803966-2803988 TGCTCAGCTTCTTGAATCTGTGG + Intergenic
1134050905 16:11136734-11136756 GGCTCAGCCTCTGAGAGCTGTGG - Intronic
1135022334 16:18973173-18973195 TCTTCATCTTCTTGGATCTGAGG + Intergenic
1135344265 16:21674983-21675005 GGTTGAGCTTCTTGGATCTGTGG + Intergenic
1135709080 16:24699884-24699906 TGCTGAGCTTCTTAGAACTTCGG - Intergenic
1136280595 16:29207159-29207181 TATCAAGCTTCTTAGATCTGTGG - Intergenic
1137678159 16:50314517-50314539 TGCTGAGCTTGTCAGATCAGAGG - Intronic
1137941388 16:52690812-52690834 TGCTGAGTTTCTTGAATCTGTGG + Intergenic
1138176507 16:54903239-54903261 CTCTGAGCTTCTTGGATCTGTGG - Intergenic
1138518734 16:57557465-57557487 TGCAGAGCTTCTTGGATCTGTGG + Intronic
1138629713 16:58283578-58283600 TTGGCAGCATCTTAGATCTGAGG + Exonic
1138781240 16:59790591-59790613 TTCTTAGCTTTTTAGATCTGTGG + Intergenic
1138842077 16:60522504-60522526 TGCTCAGCTTCTTATATTTATGG - Intergenic
1139492567 16:67294230-67294252 GGCCCAGCTTATTAGATCTTGGG - Intronic
1140607245 16:76553660-76553682 TGCTCAACTTCTTATTTATGGGG + Intronic
1141758179 16:86008946-86008968 TGTGGAGCTTCTTAGATCTGTGG + Intergenic
1142084952 16:88173100-88173122 TATCAAGCTTCTTAGATCTGTGG - Intergenic
1143045378 17:4074564-4074586 TGCTCAGCTTTCTACACCTGGGG + Intronic
1143950837 17:10631130-10631152 TACTCAGCCTCATAGATTTGGGG + Intronic
1145092508 17:19997723-19997745 TGCTTAGCTTCTGAGAGCAGGGG - Intergenic
1145356747 17:22164559-22164581 TGCTCAGCTTCTTAAGTATGTGG + Intergenic
1146165083 17:30582269-30582291 TGCTTAGCTTCTGAGAGCAGGGG - Intergenic
1148376186 17:47148555-47148577 TATTGAGCTTCTTGGATCTGTGG - Intronic
1149093257 17:52809718-52809740 TGTGGAGCTTCTTAAATCTGTGG + Intergenic
1149819499 17:59761240-59761262 TGTTCAGTTTCTTAAGTCTGTGG + Intronic
1150023924 17:61651806-61651828 GGCTGAGCTTCTTAAGTCTGAGG - Intergenic
1150236431 17:63596552-63596574 TGCTCAGTTTCTGAGATTTGGGG - Intergenic
1152522334 17:80864130-80864152 TGCTAAGCTTTGTGGATCTGTGG - Intronic
1152833583 17:82514500-82514522 TGCTGAGCTGTTTGGATCTGTGG + Intergenic
1153073163 18:1130396-1130418 TGTTGAGCTTCTTGGATGTGTGG + Intergenic
1153183167 18:2458970-2458992 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
1154167074 18:12023667-12023689 TGCTCAGCTTCCTAGTTCCTGGG + Intronic
1155776916 18:29776331-29776353 TGTTGAGCTTCTTGGATCTTGGG + Intergenic
1156138097 18:34069529-34069551 TGTTGAGCTTCTTAGATCTATGG - Intronic
1156261702 18:35450482-35450504 TGCTCAGCTTCTTGGGTCTGTGG - Intronic
1156884584 18:42119833-42119855 TGTTGAGCTTCTTGGATCTGTGG + Intergenic
1157141561 18:45112842-45112864 TACTGAGCTTCTTAAATATGTGG + Intergenic
1157203304 18:45677416-45677438 TAATCAGCCTCTCAGATCTGAGG - Intronic
1157778725 18:50418829-50418851 TTCTAAGATTCTTAGATCTGTGG + Intergenic
1157791333 18:50533990-50534012 TGCTTAGCTTCTTGAATGTGTGG + Intergenic
1159893984 18:73979426-73979448 TAATCATCTTCTTAGATATGGGG - Intergenic
1160780567 19:876229-876251 GGCTGAGCTCGTTAGATCTGAGG + Intronic
1161650762 19:5483100-5483122 TGCTCCGCTTCTTAGCCCTGTGG - Intergenic
1163923897 19:20320444-20320466 TGCACAGCCTCTTGGAGCTGAGG + Intergenic
1164489560 19:28694306-28694328 TGCTCAGCTTCTTGACTCTGTGG - Intergenic
1164815337 19:31195226-31195248 CTCTGAGCTTCCTAGATCTGTGG - Intergenic
1165403464 19:35616371-35616393 GCCTCAGATTCTAAGATCTGTGG + Intronic
1165658534 19:37554577-37554599 CCTTGAGCTTCTTAGATCTGTGG + Intronic
1166373137 19:42313481-42313503 TGCTCACCTCCTTGGAACTGAGG - Exonic
1167588763 19:50391160-50391182 TGCTCATCGTCTGAGATGTGGGG - Intronic
927369569 2:22338946-22338968 TGCTTAGCTTCCAAGATCAGAGG + Intergenic
929359771 2:41073597-41073619 TACTCAGCTTCTTGAGTCTGTGG + Intergenic
930261706 2:49154469-49154491 TGTGGAGCTTCTGAGATCTGTGG - Exonic
930877474 2:56235273-56235295 TGCTTAGCTTCCAAGATCAGAGG + Intronic
931566106 2:63617480-63617502 TGCTTAGTTTCATATATCTGTGG - Intronic
931993672 2:67818336-67818358 TGTTGAGCTTCTTGGATTTGTGG - Intergenic
932547143 2:72725054-72725076 TGTTTAGCTTCTTGGATCTGTGG - Intronic
933108354 2:78362273-78362295 TGCTCTGCTTCTTTGGCCTGAGG - Intergenic
933879077 2:86650133-86650155 TACTGAGCATCTTGGATCTGTGG - Intronic
934128572 2:88922919-88922941 TCCTGATCTTCTTGGATCTGTGG - Intergenic
934498882 2:94837300-94837322 TGCTGAACTACATAGATCTGTGG - Intergenic
934880696 2:97974484-97974506 TGTTGAGCTTCTTGGATCTCTGG - Intronic
935478497 2:103556364-103556386 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
938393728 2:130925828-130925850 TGCACAGCTTCTTAAATCTATGG + Intronic
938890085 2:135695522-135695544 TGCTGAGCTTGTTGGATCTGTGG - Intronic
939806656 2:146782121-146782143 TGTTGAGCTTTTTGGATCTGTGG + Intergenic
940826326 2:158416512-158416534 TCAACAGATTCTTAGATCTGGGG + Intronic
941913768 2:170793861-170793883 TGCTGAGTTTCTTAACTCTGTGG + Intronic
941963656 2:171278534-171278556 TGTTGAGCTTCTTGGATCTCTGG - Intergenic
942807084 2:179943864-179943886 TGCTCAGCTTGTAAGTTCTGTGG + Intergenic
944397215 2:199281837-199281859 TGCTCAGTATCTTTGTTCTGTGG + Intronic
944904593 2:204250101-204250123 TCCTCAGCTTCTTATCTATGTGG + Intergenic
944963253 2:204900989-204901011 TGCTGAGCTTCCTGGAGCTGGGG + Intronic
946262163 2:218502553-218502575 TGTTGAGCTTCTTGGATCTGTGG - Intronic
946952646 2:224893981-224894003 TGCTCATCTTCATTGTTCTGGGG + Intronic
947075437 2:226339043-226339065 TGCTCAGCTTCCTGAATCTGTGG - Intergenic
947505221 2:230703601-230703623 TGCTAAGCTGCTTGGAACTGGGG + Intergenic
947947034 2:234113575-234113597 TACTGACCTTCTTGGATCTGAGG + Intergenic
948719027 2:239884419-239884441 TGCTAAGCTACCAAGATCTGGGG + Intergenic
1168735144 20:128474-128496 CTCTGAGCTTCTTGGATCTGTGG - Intergenic
1169463713 20:5819259-5819281 TGCTCAGGTTATGAGACCTGAGG + Intronic
1169500922 20:6159724-6159746 CTCTGAGCTTCTTAGATCTGTGG + Intergenic
1169739516 20:8876953-8876975 TTCTCATCTTCTTGAATCTGGGG - Intronic
1170179202 20:13510338-13510360 TGCTTTGCTTCTTGGTTCTGGGG - Intronic
1172149826 20:32782049-32782071 TGCTGAAGTTGTTAGATCTGTGG + Intronic
1172179744 20:32995175-32995197 TGCCGAGCTTATTAAATCTGTGG - Intronic
1172857622 20:38018569-38018591 TGCTGAGTTTCTTAAATCTGTGG - Intronic
1172866214 20:38100151-38100173 TACTGAGCTTCTTGGATCTATGG - Intronic
1174765363 20:53248750-53248772 TGCCCAACTTCTTTGAGCTGTGG - Intronic
1174938667 20:54899157-54899179 TGCTGAGCTGCTTGGAACTGGGG - Intergenic
1175748656 20:61479711-61479733 TGCTGAGCTTCTTGGATCTTTGG + Intronic
1176922781 21:14708426-14708448 TTGCCAGCTTCTAAGATCTGGGG + Intergenic
1177612871 21:23475404-23475426 AGCTCAGCTGCTAAGATTTGCGG - Intergenic
1179091765 21:38272365-38272387 TGCTCAGCTTCTGCAAGCTGGGG + Intronic
1179360498 21:40703731-40703753 TGTTGAGCTCCTTGGATCTGTGG + Intronic
1179782529 21:43711226-43711248 CTCTAAGCTTCCTAGATCTGTGG - Intergenic
1179823785 21:43952530-43952552 TGTGCACCTTCTTAGATCAGGGG - Intronic
1181853412 22:25765979-25766001 TGCTCAGCATCATGGCTCTGGGG - Intronic
1182040221 22:27232673-27232695 TTTTCAGATTATTAGATCTGAGG - Intergenic
1184533032 22:45069071-45069093 TGTTGAGCTTCTGAGATATGGGG - Intergenic
1184721474 22:46316735-46316757 TCTTAAGCTTCTTTGATCTGTGG + Intronic
949254985 3:2035432-2035454 AGCTCAGCTTCTGAGATCTGTGG + Intergenic
949366213 3:3284177-3284199 TCCTCAGCTTTCTGGATCTGTGG + Intergenic
949470353 3:4389467-4389489 TGCTTAGCTCCTTGAATCTGTGG + Intronic
949757536 3:7430305-7430327 TGTTCAGCTTCTAAGATGTTTGG + Intronic
950115373 3:10447368-10447390 TGCTCAACTTCCCAGCTCTGGGG + Intronic
950724128 3:14905395-14905417 TCTTGAGCTTCTTGGATCTGTGG + Intronic
951029172 3:17862704-17862726 TGCTGAGCTTCTTGGAGCTAGGG + Intronic
951087059 3:18525185-18525207 TGCTAAGCTTCTTATATATGTGG + Intergenic
952606091 3:35148189-35148211 TGCTCAGCTTCTTATTCCTCAGG - Intergenic
952915670 3:38238818-38238840 TGTTGAGCTTCTTGGATCTGTGG + Intronic
952934645 3:38387149-38387171 CACTGAGCTTCTTGGATCTGTGG + Intronic
952962401 3:38600712-38600734 TGCTCTGCATCTTTGTTCTGAGG - Intronic
953019205 3:39103277-39103299 TGCTCAGCTTCTGAGCTCTGTGG - Intronic
953511638 3:43546924-43546946 TGCTCAGCTTCTTAGATCTGTGG - Intronic
953860444 3:46539972-46539994 TGGTCAGCTTCTGAGGTCAGGGG - Intronic
955075355 3:55608238-55608260 TGCTCTGCTTCTTAGAAGTGAGG - Intronic
955447298 3:59027079-59027101 TGCTCTGCTTCCTAGTTGTGTGG - Intronic
955480339 3:59383514-59383536 TGCTCTGCTTTTTAGATTTGAGG + Intergenic
956170146 3:66426830-66426852 GGCACAGCTTCTTAGATCTTAGG - Intronic
956691670 3:71883915-71883937 TGCTGAGCTTCTTGAATCTATGG - Intergenic
956812588 3:72878812-72878834 TTCTGAGCTTCTTGGATCTGTGG + Intergenic
957597214 3:82282829-82282851 TGTTCAGGTTTTTTGATCTGTGG + Intergenic
957898393 3:86453412-86453434 TGCTCAGCTTTTTGAATCTGTGG - Intergenic
958030397 3:88102194-88102216 TTTTAAGCTTCTTGGATCTGTGG + Intronic
959320219 3:104864024-104864046 CTCTCAGCTTCTTAGATCTGTGG - Intergenic
960153434 3:114274376-114274398 TGCTGAGCTTCTTGGAGCTGGGG + Intergenic
960667206 3:120121689-120121711 TGCTGAGCTTCTTGGTTCTGTGG - Intergenic
961329555 3:126130588-126130610 TGCTCAACTGCTTAGAGCTGTGG - Intronic
961742125 3:129039571-129039593 TGCCCAGCTTCCTCGCTCTGTGG - Intronic
962389153 3:134957274-134957296 TGGTCTGCTGCTTAGAGCTGGGG - Intronic
963459710 3:145594838-145594860 TCTTCAGCTTCTGAAATCTGTGG - Intergenic
963528626 3:146446524-146446546 TGCTGAGCTGCCTAGATCTGGGG + Intronic
966014476 3:175124436-175124458 TGCTTAGATGCCTAGATCTGTGG - Intronic
966105944 3:176334163-176334185 TGCTTAGCTTCTTGAATCTGTGG - Intergenic
969275342 4:6131322-6131344 TTCTGAGCTTCCTGGATCTGTGG - Intronic
969857173 4:10009379-10009401 TGATCAGGTTCTAACATCTGTGG + Intronic
969872858 4:10115827-10115849 TGCTTAGCTTCCAAGATCAGAGG + Intronic
970340117 4:15097393-15097415 TGCTTAGCTTCTGAAATCAGCGG + Intergenic
970478932 4:16453151-16453173 GGCTGGGCTTCTTAGACCTGAGG - Intergenic
971599717 4:28576690-28576712 GTCTCAGCTTCTTACTTCTGTGG + Intergenic
972253928 4:37333363-37333385 TGCTGAGCTTCCTGGAGCTGGGG - Intronic
973734690 4:53859436-53859458 TGCAAAACTTCTTAAATCTGTGG + Intronic
973899009 4:55447539-55447561 TGCTTTGCCTCTTAGGTCTGTGG - Intronic
973919696 4:55672877-55672899 TGCTGAGCTTCCTGGAACTGGGG + Intergenic
974525830 4:63049014-63049036 TTCTGAGCTTCCTTGATCTGTGG + Intergenic
974862913 4:67545408-67545430 TGCTCGGCTTCCTGGAGCTGTGG - Exonic
976025724 4:80686018-80686040 TTCTTAGCATCTTACATCTGGGG - Intronic
976253589 4:83077955-83077977 TTCTTAGCTTCCTGGATCTGTGG - Intergenic
977587572 4:98791188-98791210 TGTTGAGCTTCTTGAATCTGTGG - Intergenic
977684870 4:99836350-99836372 TGGTCAGCCTCTCTGATCTGGGG - Intronic
977708100 4:100093728-100093750 AGCTAAGCTTCTGAGAACTGGGG + Intergenic
978136411 4:105266872-105266894 TGCTGAGCTGCTGAGATCTGTGG - Intronic
979772249 4:124542068-124542090 TTCTCAGTTTCTGAGATCTGTGG - Intergenic
980086145 4:128392170-128392192 TGCTCAGCTTCTCCGATATTAGG - Intergenic
980469929 4:133238377-133238399 TGTTGAGTTTCTTGGATCTGTGG + Intergenic
981498913 4:145425549-145425571 TGTTGAGCTTCTTGAATCTGTGG + Intergenic
981622199 4:146714539-146714561 TGTTGAGCTTCTTGGATCTATGG - Intronic
981786942 4:148490141-148490163 TGCTCTGCTTTTTAGATGGGGGG + Intergenic
982276755 4:153643650-153643672 TGCTCAGCTATTCAGAGCTGTGG + Intergenic
982516854 4:156363333-156363355 CTCTCTGCTTCTTTGATCTGGGG - Intergenic
982911675 4:161149506-161149528 TGCTGAGCTTCGTGGAGCTGGGG - Intergenic
983337963 4:166420612-166420634 TGCTGAGCTGCCTAGAACTGAGG + Intergenic
984731444 4:183071643-183071665 TGATAAGTTTCTTAAATCTGTGG - Intergenic
984926404 4:184810999-184811021 TGCTCAGCTCTTGAGGTCTGTGG - Intronic
985625699 5:984995-985017 TGCAGAGCTTCATAGATATGTGG - Intergenic
985690480 5:1308564-1308586 TGTTGAGCTTCTTGGATCTGTGG + Intergenic
986237515 5:5925942-5925964 TGCTGAACTACTGAGATCTGGGG + Intergenic
987476992 5:18402570-18402592 TGCTCAGATTTTTGTATCTGTGG - Intergenic
987558208 5:19482920-19482942 CGCTTAGCTTCTGAGATCAGAGG - Intronic
989064775 5:37449184-37449206 TGCTCAGCTTGTTTCAACTGTGG + Intronic
991150023 5:63356891-63356913 CTCTGAGCTTCCTAGATCTGTGG + Intergenic
991358621 5:65795953-65795975 TGCTCACATTTTTGGATCTGAGG + Intronic
991684523 5:69169357-69169379 AGTTCAGCTTCTTATATCTAAGG + Intronic
992033513 5:72748131-72748153 CTCTGAGCTTCCTAGATCTGTGG - Intergenic
992649359 5:78842507-78842529 TGTCCAGCTTCTTCGGTCTGGGG - Intronic
993935252 5:93991900-93991922 TGTTGAGCTTCTTGGATCTGTGG - Intronic
995137417 5:108695052-108695074 TGCTGAGCTTCTTATATCTGTGG - Intergenic
995741074 5:115356210-115356232 TGTTAAGCTTCTGAGATTTGGGG + Intergenic
995765142 5:115606399-115606421 TGTTTGGCATCTTAGATCTGTGG - Intronic
996956498 5:129188645-129188667 TGCTGAGCTTCTTGGATCTGGGG - Intergenic
997003161 5:129785519-129785541 TGCTGAGCTACCTGGATCTGGGG - Intergenic
997059952 5:130488849-130488871 TGCTGAGCTGCCTAGAGCTGGGG - Intergenic
997218272 5:132133372-132133394 TTCTCTGATTCTTAGATCTGTGG + Intergenic
997565079 5:134880949-134880971 TGTTGAGCTTCTTAGATCTATGG + Intronic
998169311 5:139863203-139863225 TGCTGAGCTTACTAGCTCTGGGG - Intronic
998281889 5:140818072-140818094 TTCAAAGCTTCTTATATCTGTGG + Intronic
998312180 5:141144548-141144570 TGTTCAGCTTCTTGAATCTCTGG - Intronic
998526729 5:142849541-142849563 TGCTCACCTTCTTTGTCCTGTGG + Intronic
998720815 5:144946606-144946628 TGCTCAGTCTCTTAGATCTGAGG - Intergenic
999508784 5:152226115-152226137 TGCTAAGATTCTTTGAGCTGTGG - Intergenic
1000361081 5:160447911-160447933 TGCTGAGCTTGTTGGATCTCTGG + Intergenic
1001267461 5:170284570-170284592 TGTTGAGCCTCTTGGATCTGTGG + Intronic
1001969377 5:175941657-175941679 TATTGAGCTTCTTGGATCTGTGG - Intronic
1002248060 5:177902092-177902114 TATTGAGCTTCTTGGATCTGTGG + Intergenic
1002314592 5:178334899-178334921 TGGTCAGCTGCCTGGATCTGAGG - Intronic
1003618869 6:7679843-7679865 TGGTCATGTTCTTAGAACTGGGG + Intergenic
1003922243 6:10843729-10843751 ATCTGTGCTTCTTAGATCTGTGG + Intronic
1004840056 6:19573489-19573511 AGCTCAGCTTCTCAACTCTGTGG - Intergenic
1005437099 6:25825659-25825681 CTCTGAGCTTCTTGGATCTGTGG + Intronic
1006168257 6:32078568-32078590 TGCTTAGCTTCTGAGATCAGAGG + Intronic
1006433399 6:34012752-34012774 TGGTGAACTTCTTGGATCTGTGG - Intergenic
1007434872 6:41803167-41803189 TACTTAGCTTCTTAGTGCTGTGG - Intronic
1007555027 6:42758537-42758559 TACTTAGCTTCTGAGCTCTGAGG - Intronic
1011271201 6:85581116-85581138 TGCTGAGCTTCCTGGAGCTGGGG - Intronic
1011498228 6:87959427-87959449 TGTTGAGCTTCTCAGATATGTGG + Intergenic
1013195636 6:107843170-107843192 TTCTGAGCTTCTTAGATCTGTGG - Intergenic
1013573298 6:111452107-111452129 TGTTCAGATTCTTAGACCTTAGG + Intronic
1014073816 6:117214728-117214750 TGCTGAGCTGCCTAGAGCTGGGG + Intergenic
1014142431 6:117959492-117959514 TGCTCAGCGTGTCATATCTGAGG + Intronic
1014579557 6:123120249-123120271 TGCTGTACTTTTTAGATCTGTGG + Intergenic
1015652849 6:135482069-135482091 TGTTGAGCTTCTCTGATCTGTGG + Intronic
1015762086 6:136673896-136673918 TGCTGAGCTTCTTGAATCTGTGG - Intronic
1016228378 6:141771355-141771377 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
1016347725 6:143132576-143132598 TGTTGAGCTTCTTGGATCTGTGG + Intronic
1016378563 6:143449835-143449857 TGCTTAGCTTCCGAGATCGGGGG - Intronic
1016476498 6:144433726-144433748 TGCCCATCTTCTGAGATGTGGGG - Intronic
1016623712 6:146142273-146142295 TGCTGAGCTTCCTGGAGCTGTGG + Intronic
1016752184 6:147642993-147643015 TGCTAAATTTCTTGGATCTGGGG - Intronic
1017074588 6:150606003-150606025 TCCTCTGTTTCTTAGCTCTGGGG + Intronic
1017739108 6:157390405-157390427 TGCCGAGCTTCTTGGATCTGTGG + Intronic
1017782303 6:157725304-157725326 TGTGGAGCTACTTAGATCTGTGG + Intronic
1018250990 6:161870118-161870140 TGCTTAGCTTCCAAGATCAGAGG + Intronic
1018335341 6:162781022-162781044 TACTGAGCTTCTTAGATCTGTGG - Intronic
1018504834 6:164454728-164454750 TTCTGAGCTTCTTGGATTTGCGG - Intergenic
1019001283 6:168755005-168755027 TATTGAGCTTCTTGGATCTGAGG - Intergenic
1020446120 7:8269887-8269909 TGCTGAGCTTCTTGGAGCTGTGG + Intergenic
1021056364 7:16051905-16051927 TTCTCAGATTCTAAGATCTGGGG - Intergenic
1021277909 7:18678335-18678357 CACTGAGCTTCTTATATCTGTGG + Intronic
1021734518 7:23629957-23629979 TGCTCAGCTTCTTAAATCTGAGG - Intronic
1021783738 7:24132740-24132762 TGCTTAGCTTCTGAGATTAGAGG - Intergenic
1022338648 7:29447572-29447594 TGCTAAGATTCTTGGATCTCTGG - Intronic
1022690862 7:32651733-32651755 TGCTCAGCTTCTCAAATCATAGG + Intergenic
1022770216 7:33463030-33463052 TGCTCAGCTAAATAGATCTGGGG + Intronic
1023035291 7:36126343-36126365 TGCCCAGAGTCTTAGAGCTGGGG + Intergenic
1024262623 7:47583269-47583291 TTCTCAGCTGTTTGGATCTGGGG - Intergenic
1024275208 7:47671641-47671663 AGCTCAGCTGCTGAGATCTATGG + Intergenic
1024510714 7:50202607-50202629 TGTGCAGCTTCTTTGAGCTGTGG + Intergenic
1028803422 7:94995313-94995335 TGTTGAGCTTCTTGGATCTATGG + Intronic
1029336117 7:99900944-99900966 TGTTGAGCATCTTGGATCTGTGG + Intronic
1031997660 7:128243239-128243261 TGCTCAGTTTGTTAGCTCTATGG + Intronic
1032058169 7:128700786-128700808 CTCTGAGCTTCTTGGATCTGAGG - Intergenic
1033878042 7:145846367-145846389 CACTTAGCTTCTTGGATCTGTGG - Intergenic
1034581667 7:152049496-152049518 TGCTGAGCTTCCTGGAGCTGGGG + Intronic
1035232382 7:157473384-157473406 TGCTCAGATTCTTGAATTTGTGG + Intergenic
1040735292 8:50500064-50500086 TGTTAAGCTTCTTAAATCTGTGG + Intronic
1042418160 8:68551018-68551040 CTCTGAGCTTCTTGGATCTGTGG + Intronic
1042441631 8:68834127-68834149 TATTAAACTTCTTAGATCTGTGG - Intergenic
1042564653 8:70099846-70099868 TTGTGAGCTTCTTGGATCTGTGG + Intergenic
1042778192 8:72459171-72459193 CACTCAGCTTCCTGGATCTGTGG + Intergenic
1042824974 8:72971082-72971104 TGCTGAGATTCCTGGATCTGTGG - Intergenic
1043084275 8:75809138-75809160 TGCTCTCCTGGTTAGATCTGAGG + Intergenic
1044215364 8:89603238-89603260 TGCTCAGTTTATGAGATGTGTGG + Intergenic
1044492596 8:92837129-92837151 TGTTGAGCTTCTTAGATCTGTGG + Intergenic
1044492721 8:92839023-92839045 TGTGGAGCTTCTTAGATTTGTGG + Intergenic
1044776709 8:95696932-95696954 TGCTAAGCTTCTTGAATCTGTGG - Intergenic
1044811698 8:96070176-96070198 TGTTGAGCTTCTTGGATCTGTGG + Intergenic
1045507641 8:102789766-102789788 TTCTCAGCTTCTTATCTGTGGGG + Intergenic
1045648454 8:104321647-104321669 GGCTCAGCTCCTTACAGCTGTGG - Intergenic
1046457347 8:114484166-114484188 TGCTCAGCTCCTCAGGTATGAGG - Intergenic
1046682659 8:117187835-117187857 TGTTGAGCTTCTTGGACCTGGGG - Intergenic
1047128875 8:121995694-121995716 TGCTCAGCTTCTGAGGCCTCAGG + Intergenic
1047352311 8:124087950-124087972 TGCTCAGCTTCCTGGAGCTGGGG + Intronic
1048466233 8:134666889-134666911 TGCTCAGCTTCTTGAATTAGTGG - Intronic
1048920038 8:139219828-139219850 TTCTGAGCCTCTTGGATCTGTGG - Intergenic
1048935460 8:139351598-139351620 GGGTCAGCTTCTGAGATTTGGGG + Intergenic
1049049220 8:140180891-140180913 TGTTCAGCTTCTTGGATCTGAGG + Intronic
1049255911 8:141613688-141613710 TGTTCAGCTGCAGAGATCTGGGG - Intergenic
1050599989 9:7240917-7240939 TACTCATCTTCTTTAATCTGCGG - Intergenic
1052578071 9:30316163-30316185 TTCTGAGCTTCTTGGATCTGTGG + Intergenic
1052649918 9:31289450-31289472 TGCTAAGCTTTGTAGACCTGTGG - Intergenic
1053658277 9:40243255-40243277 TGCTGAACTACATAGATCTGTGG + Intronic
1053908649 9:42872529-42872551 TGCTGAACTACATAGATCTGTGG + Intergenic
1054370400 9:64389530-64389552 TGCTGAACTACATAGATCTGTGG + Intronic
1054526321 9:66132966-66132988 TGCTGAACTACATAGATCTGTGG - Intronic
1054678028 9:67879285-67879307 TGCTGAACTACATAGATCTGTGG + Intronic
1055004795 9:71493302-71493324 TTCTGAGCTTCCTGGATCTGTGG - Intergenic
1055581170 9:77708210-77708232 CTCTGAGCTTGTTAGATCTGTGG + Intergenic
1055881179 9:81005700-81005722 TTCTGAGCTTCTCAGATCTGTGG - Intergenic
1056302767 9:85258805-85258827 TGCCCAGCTTAGTATATCTGTGG - Intergenic
1056401899 9:86235946-86235968 CTCTGAGCTTCTTGGATCTGTGG - Intronic
1056649593 9:88446932-88446954 TGTTGAGCTTGTTAGCTCTGTGG + Intronic
1057260858 9:93582528-93582550 TTCTCAGCTTTTTGGCTCTGTGG + Intronic
1057641644 9:96828815-96828837 TATTTAGCTTCTTGGATCTGAGG - Intronic
1058004062 9:99896421-99896443 TGATGAGCTTCCTGGATCTGGGG - Intergenic
1059683458 9:116609209-116609231 TGTTGAGCTTCTTGGATCTGTGG - Intronic
1059920126 9:119150951-119150973 TGCTCTACTTCTTAAAACTGAGG + Intergenic
1060166584 9:121422409-121422431 TGCTAAGCTGCCTAGAGCTGGGG + Intergenic
1061534707 9:131240302-131240324 TGCTCAGCTTGGTACATGTGAGG + Intergenic
1061887200 9:133597617-133597639 TGTTGAGCTTTTTGGATCTGTGG - Intergenic
1187082093 X:16001331-16001353 TGTTCAGCTTCTTGAATCTGTGG + Intergenic
1187271853 X:17787413-17787435 AGCTCAGCTTCTCAGACCTCAGG - Intergenic
1187319701 X:18228374-18228396 AGCTCAGCTTCTCAGACCTCAGG + Intergenic
1188998984 X:36922876-36922898 TGCTGAGCTGCTTGGAGCTGGGG + Intergenic
1190910870 X:54771194-54771216 TCCTAAGCTTCTTAGACCTGAGG + Intronic
1191641408 X:63432332-63432354 TGCTCTTCCTTTTAGATCTGGGG - Intergenic
1191674050 X:63776582-63776604 AGCTCAACTCCTTAGATCAGGGG - Intronic
1192627190 X:72742241-72742263 TGTTCAGCTTCTTGGATGTGTGG + Intergenic
1192654518 X:72978572-72978594 TGTTCAGCTTCTTGGATGTGTGG - Intergenic
1193052301 X:77114664-77114686 TGCTGAGCTTCCTGGAGCTGGGG + Intergenic
1193255064 X:79338769-79338791 TTCTCAGCTTCCAGGATCTGTGG + Intergenic
1193882592 X:86942446-86942468 TCCTGAGCTTTCTAGATCTGTGG - Intergenic
1193990601 X:88301861-88301883 TGCTCAGCAACTTGGATCTGTGG - Intergenic
1194489403 X:94527971-94527993 TTCACAGCTTCTTAGAGCAGGGG + Intergenic
1195909777 X:109877106-109877128 TGCTTAGGTTCTTAGATTTTTGG + Intergenic
1197439433 X:126471664-126471686 TGCTGAGCTTCCTGGAGCTGGGG - Intergenic
1197866382 X:131023084-131023106 TGTTGAGATTCTTAGATTTGTGG + Intergenic
1198510735 X:137349044-137349066 TGTTGAGCATCTGAGATCTGTGG + Intergenic
1199555923 X:149108632-149108654 CACTAAGCTTCCTAGATCTGTGG + Intergenic
1199583675 X:149388042-149388064 TGTTGAGCTGCATAGATCTGTGG - Intergenic