ID: 953513961

View in Genome Browser
Species Human (GRCh38)
Location 3:43572081-43572103
Sequence GTCTCCTCCTTCTGTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953513961_953513975 29 Left 953513961 3:43572081-43572103 CCCACCCAACAGAAGGAGGAGAC 0: 1
1: 0
2: 0
3: 45
4: 221
Right 953513975 3:43572133-43572155 ACCACCCAGGTAGCCCAAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 102
953513961_953513970 16 Left 953513961 3:43572081-43572103 CCCACCCAACAGAAGGAGGAGAC 0: 1
1: 0
2: 0
3: 45
4: 221
Right 953513970 3:43572120-43572142 CCAACCCCAACCTACCACCCAGG 0: 1
1: 0
2: 1
3: 32
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953513961 Original CRISPR GTCTCCTCCTTCTGTTGGGT GGG (reversed) Intronic
900787747 1:4659346-4659368 GTCTCCTCCTTGTGTCTGATTGG - Intronic
901234032 1:7657901-7657923 TTCTCCTCCTTATGTTGTGAAGG - Intronic
902518395 1:17002122-17002144 AGCTCCTCCTTCTGATGGCTTGG - Intronic
902873280 1:19326737-19326759 GTCTACTCCCGCTGTTGGCTTGG + Intronic
902874760 1:19334142-19334164 GTCTCTGCCTACTGTTTGGTGGG - Intergenic
904974233 1:34443427-34443449 GTCTCCTCCTTCTCTTCAGGGGG + Intergenic
906154661 1:43606865-43606887 GGCTCCTCCTGCTGCTGGGCTGG - Exonic
906367384 1:45222462-45222484 GTCTCCTCATTTTGTGGAGTTGG - Intronic
906655811 1:47547745-47547767 GGCTCTTCCTTCTGTTCAGTGGG + Intergenic
906872702 1:49502075-49502097 GTGTTCTGCTGCTGTTGGGTGGG + Intronic
906988958 1:50717009-50717031 ATTTCTTCCTTCTGGTGGGTTGG - Intronic
908405273 1:63808250-63808272 TTTTTCTCCTTCTGTTGGGCTGG + Intronic
910609571 1:89127151-89127173 GTTTCTTCCTTTTGGTGGGTTGG + Intronic
912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG + Intergenic
913987250 1:143576180-143576202 GTTTCTTCCTTCTCGTGGGTTGG - Intergenic
916078141 1:161215087-161215109 GTCTCCTCATTCTGTGGGTTAGG + Intergenic
917236785 1:172901292-172901314 TTCTCCTCCTTCAGTTGGGCAGG + Intergenic
918059176 1:181046917-181046939 GTTTCTTCTTTCTGTTGGGTTGG - Intronic
918277975 1:182972917-182972939 GTCTCTTTGTTCGGTTGGGTGGG - Intergenic
922712515 1:227844638-227844660 GGCTCCTCCTTATGTGTGGTGGG + Intronic
922712570 1:227844858-227844880 GACTCCTCCCTATGTGGGGTGGG + Intronic
922718416 1:227888402-227888424 GAATCCTGCTTCTGTTGGGTAGG + Intergenic
923771905 1:236944885-236944907 TTCTCATCCTTCTGTAGGCTGGG - Intergenic
1063593000 10:7410356-7410378 GTCTCCCCTTTCTTTTGGTTTGG - Intronic
1064039340 10:11945413-11945435 TTCTCCTCCTTATGTTTGGAGGG + Intronic
1065183671 10:23151291-23151313 GTCTGCACCTGCTGTTGGGCTGG - Intergenic
1065320625 10:24505757-24505779 ACCTCCTCCTTCTCTTGGGAAGG - Intronic
1066482113 10:35806736-35806758 TTCTCCTCCTTCTGTTTTTTTGG - Intergenic
1067583104 10:47457907-47457929 GGCTCCTCCTTCTCCAGGGTTGG + Intergenic
1067744650 10:48926461-48926483 GTCTCCTCAATCTGTTGCGTTGG - Intronic
1068093806 10:52465631-52465653 TTCTCATGCTTGTGTTGGGTAGG + Intergenic
1068400014 10:56516324-56516346 ACTGCCTCCTTCTGTTGGGTGGG + Intergenic
1068417609 10:56744616-56744638 GTTTCTTCCTTCTGGTGGGTTGG + Intergenic
1069902557 10:71714477-71714499 GTCTCCTACCTCTCTTGGGGAGG - Exonic
1070981212 10:80649691-80649713 GTCTCCTCCTACCGGGGGGTGGG - Intergenic
1074732635 10:116394475-116394497 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
1076519160 10:131069314-131069336 GGCATCTCCTACTGTTGGGTAGG + Intergenic
1076997625 11:306451-306473 TCCTCCTCCTTCTGCTGGCTGGG - Intergenic
1077123592 11:922414-922436 TTCTCCTCCTTCAGGTGGGCTGG + Intergenic
1077465552 11:2732172-2732194 CTCTCAGCCTTCTGTTTGGTGGG + Intronic
1078680107 11:13467838-13467860 GCCTCCTGGTTATGTTGGGTAGG - Intergenic
1084352898 11:68616009-68616031 GTCAGCTTTTTCTGTTGGGTGGG + Intergenic
1084454077 11:69257355-69257377 GCCTCTTCCTTCTGGTGGGAGGG + Intergenic
1084671491 11:70609207-70609229 GTCTGATTCCTCTGTTGGGTGGG - Intronic
1085245778 11:75099348-75099370 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
1085356862 11:75846297-75846319 GTGTTCTCCATCTGGTGGGTGGG + Intronic
1085727058 11:78963285-78963307 GCCTCCTCCTTCTGAAGAGTTGG - Intronic
1088598361 11:111456053-111456075 GGCTCCTTCTTCTTTTGGGCAGG - Intronic
1090394217 11:126408207-126408229 GTCTCTTCCTACTGTTGTTTGGG + Intronic
1090858764 11:130634484-130634506 GCCTCCTCCTGCTGTTGGAGTGG + Intergenic
1091112375 11:132981801-132981823 GTTTCTTCATTCTGTTGGTTTGG - Intronic
1092688821 12:11084106-11084128 GTGTCCTTCTCCTGTTGGCTGGG - Intronic
1093587740 12:20861354-20861376 GGTTTCTCCTTCTGTTTGGTTGG - Intronic
1093600940 12:21021793-21021815 GGTTTCTCCTTCTGTTTGGTTGG - Intronic
1094217067 12:27953920-27953942 TTCTCATCCTGATGTTGGGTTGG + Intergenic
1094425483 12:30312568-30312590 GTCTCCTACTATTGTTGTGTGGG - Intergenic
1095393826 12:41740876-41740898 CTATTCTCCTTCTCTTGGGTTGG - Intergenic
1095962127 12:47842265-47842287 TCCTTCTCCTTCTGATGGGTTGG + Intronic
1098925403 12:76343878-76343900 GTCTGTTCCTTTTCTTGGGTGGG + Intergenic
1100350826 12:93780764-93780786 GTCTCTTCCTTCTGTTGCCCAGG + Intronic
1101455391 12:104825816-104825838 ATGGCCTCCTTCTGTGGGGTGGG - Intronic
1103071966 12:117951818-117951840 TTGTCCTCCTTCTGTTGAGTTGG - Intronic
1103454386 12:121053508-121053530 ATCACCTCCTTGGGTTGGGTGGG + Intergenic
1107048539 13:36021923-36021945 GTATTCTGCTTTTGTTGGGTGGG - Intronic
1107336351 13:39359984-39360006 GTCTCCTCTTTCTGTTGAAGTGG - Intronic
1107341539 13:39412165-39412187 GTCTCCTGATTCAGTTAGGTAGG - Intronic
1108059951 13:46522801-46522823 TTCTCCTGCTCTTGTTGGGTTGG - Intergenic
1108117803 13:47149167-47149189 GTCTCCTGCTTTTATTGTGTGGG + Intergenic
1108685294 13:52814367-52814389 GTTTCTTCCTTTTGGTGGGTTGG + Intergenic
1109007921 13:56901922-56901944 GTTTTCTCCTTCTGGTGGGTAGG - Intergenic
1109464559 13:62712520-62712542 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
1110945579 13:81411427-81411449 TCCTCCTCCTCCTGTTAGGTTGG + Intergenic
1111591199 13:90349623-90349645 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
1112077597 13:95930824-95930846 GTTTTCTCCTTCTGGTGGGTTGG + Intronic
1114265131 14:21069381-21069403 GCCCCTTCCTTCTGTTGGGGTGG - Intronic
1114386964 14:22265641-22265663 GTCTTCTGGTTCTGTTGGTTGGG - Intergenic
1116400168 14:44497084-44497106 ATCACCTTCTTCAGTTGGGTGGG - Intergenic
1118013553 14:61635364-61635386 GTTTTCTCCTTGTGTTGAGTTGG - Intronic
1118590201 14:67395346-67395368 CTCTCCTGCCTGTGTTGGGTGGG - Intronic
1118604581 14:67493400-67493422 GTGTCCTCCCTGTGTTGGCTGGG - Intronic
1121126002 14:91407089-91407111 CCGTCCTCCTCCTGTTGGGTGGG - Intronic
1121568777 14:94930721-94930743 GTCTCATCCATCAGTAGGGTGGG + Intergenic
1121604328 14:95229518-95229540 GTTTCCTCCTTCTGATAGGAGGG + Intronic
1121632009 14:95428124-95428146 GCCTCCTCTTTCTGTGAGGTGGG - Intronic
1123971637 15:25513362-25513384 GTCTGGTGCTTCTGCTGGGTGGG + Intergenic
1124603644 15:31154392-31154414 GTCTCCTCCTTCTGTGAGACAGG + Intronic
1124869178 15:33523419-33523441 GTTTGCTCCTTCCGGTGGGTTGG - Intronic
1127034430 15:54899398-54899420 GTTTTATCCTTCAGTTGGGTAGG + Intergenic
1127398202 15:58560216-58560238 ATGTCCTCCTACTGATGGGTTGG - Intronic
1127907658 15:63388319-63388341 AGCTCCTACTTCTGTTGAGTGGG + Intergenic
1130159083 15:81380986-81381008 GTCTTCTGCATCTTTTGGGTGGG + Intergenic
1130258298 15:82336007-82336029 GTCTCCTCCCTCTGTCGCCTAGG - Intergenic
1130596628 15:85253953-85253975 GTCTCCTCCCTCTGTCGCCTAGG + Intergenic
1131325153 15:91436198-91436220 GCCTCCTCCCTCTCTTGGGAAGG + Intergenic
1132300237 15:100770841-100770863 GTCTCTTCCTTCCCTCGGGTTGG + Intergenic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1132850644 16:2023491-2023513 GTCACCTCCTTCTGTCGCGCTGG + Intergenic
1133441343 16:5823543-5823565 CTCACCTCCTTCTGTGTGGTTGG - Intergenic
1133481807 16:6178080-6178102 TACTCTTCCTTCTGTTGGTTAGG - Intronic
1134317497 16:13132656-13132678 GTCTCCTCCTTGTGATTGTTTGG + Intronic
1135080075 16:19426604-19426626 GCGTCCTCCTTCTTCTGGGTTGG + Intronic
1135831763 16:25780531-25780553 TTCTCCTCCTTCTTTAGGGATGG - Intronic
1140897691 16:79339399-79339421 CTCTTCTCCTTCTGCTGGCTGGG + Intergenic
1141300396 16:82810331-82810353 ATCTCCTCCTTCTGTTCGGCAGG - Intronic
1141899888 16:86984306-86984328 TTATCCTCCTTCTATTGGTTGGG + Intergenic
1142471629 17:166294-166316 GCCTCCACCTTCTGTGGGGCTGG + Intronic
1146955436 17:36934403-36934425 GTCACCTCCCTCTGGTGGGCAGG - Intergenic
1147158329 17:38556658-38556680 GACTCCTGCTTCTTCTGGGTTGG - Intronic
1147451385 17:40506996-40507018 TTTTCCTCCTCCTGTTGTGTAGG + Intergenic
1148779005 17:50111281-50111303 GTCTGCTCCAGTTGTTGGGTTGG - Exonic
1152590550 17:81209387-81209409 GTCTCCTCCGTCAGCAGGGTGGG + Intronic
1154268934 18:12902434-12902456 GTTTCCTCCTGCCGTTGGGCTGG + Intronic
1154350349 18:13578022-13578044 GCCTCCTACTTCTTTTTGGTGGG + Intronic
1156391049 18:36651074-36651096 TCCCCTTCCTTCTGTTGGGTTGG + Intronic
1156683724 18:39619501-39619523 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
1157602948 18:48905407-48905429 CCCTCCACCTTCTATTGGGTGGG - Intergenic
1158266516 18:55665437-55665459 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
1159640975 18:70862464-70862486 GTCTCTTTATTCTGTTGGGTAGG + Intergenic
1159684113 18:71395015-71395037 GTGTCCTTCTTTTGCTGGGTGGG + Intergenic
1160480899 18:79238748-79238770 TCCTCCTCCTGCTGTTGGGGTGG + Intronic
1160957636 19:1700707-1700729 CTCTCCTCTTGCTGTGGGGTGGG + Intergenic
1161292618 19:3503325-3503347 GTCTGCGTCTTCTGTTCGGTGGG + Intergenic
1161861062 19:6798666-6798688 TTTTCCCCCTTCTTTTGGGTGGG - Intronic
1162606073 19:11709079-11709101 GTTTACTCCTTCTCTTGGTTGGG - Intergenic
1163723590 19:18910132-18910154 GCCCCCTCCTGCTGTGGGGTCGG - Intronic
1164450075 19:28353690-28353712 GTATTCTGCTACTGTTGGGTGGG - Intergenic
926121797 2:10245291-10245313 GTCTCCTCCTGCTGATGGCTGGG - Intergenic
927384770 2:22520535-22520557 GTCTCCTCCTTCTCTTTTTTTGG + Intergenic
927528109 2:23767312-23767334 GTGTCCTTCTCCTGTTGGCTAGG - Intronic
927615496 2:24589583-24589605 ATCTCCAGCTTCTGTTGAGTAGG + Intronic
932424168 2:71618855-71618877 GTTTCCTCACTCTGTCGGGTGGG + Intronic
938142625 2:128809120-128809142 GTCACCTTCTTCTGTTAGGAGGG + Intergenic
938725869 2:134108603-134108625 GTTTCTTCCTTCTGGTGGGTTGG + Intergenic
939869416 2:147510474-147510496 GTCTCCTCCTTCTGGGTGGTGGG + Intergenic
939892705 2:147756417-147756439 GTCTCTTCCTCCTGTTGAGTGGG + Intergenic
941093490 2:161208056-161208078 CTTTCCTCCTTCTGTTTGGTGGG + Intronic
941677416 2:168358342-168358364 GTTTTCTGCTTGTGTTGGGTTGG + Intergenic
943024378 2:182609631-182609653 GTTTGTTCCTTCTGGTGGGTTGG - Intergenic
945276213 2:207990020-207990042 CACTCCTCCTTCTCATGGGTGGG + Intronic
945524266 2:210868477-210868499 GTCTCCTGCTACTATTGTGTGGG - Intergenic
1169283786 20:4290168-4290190 GTCTCCTCCTTCTGGAGGCTGGG - Intergenic
1169460398 20:5789810-5789832 GTCACCTTCTTCAGTTGGGTAGG - Intronic
1171143677 20:22764008-22764030 GCCTCCTCCTTCTGTTAAGTGGG - Intergenic
1172234211 20:33358985-33359007 GTCTCCCCTTCCTGTTGGGGAGG + Exonic
1173864052 20:46302991-46303013 GCCTCATCCTGCTGCTGGGTGGG - Intronic
1177366970 21:20151830-20151852 GGCCCCTGCTGCTGTTGGGTGGG - Intergenic
1179239608 21:39578397-39578419 GTGTCCTTCTCCTGTTGGCTGGG + Intronic
1181678387 22:24472957-24472979 GTCTCCTCCCTCTGTTGCCCAGG - Intergenic
1184949945 22:47834139-47834161 ATCCCTTGCTTCTGTTGGGTTGG - Intergenic
949762477 3:7486688-7486710 GTCTCATCATTCTGGTGGCTGGG - Intronic
950155167 3:10716504-10716526 TTTTCCTCCTCCTGTTGGGAGGG + Intergenic
951190021 3:19757197-19757219 TTCTCCTCCTTCTTTTAGGTTGG - Intergenic
953513961 3:43572081-43572103 GTCTCCTCCTTCTGTTGGGTGGG - Intronic
953568319 3:44051811-44051833 GTATCCTCCACCTGTTGGGAGGG - Intergenic
954138714 3:48594296-48594318 GTCTCCTCCCTCTCTGGGGAAGG + Intronic
954820354 3:53321134-53321156 GCCCCCTTCTTATGTTGGGTGGG + Intronic
954885031 3:53865309-53865331 GTCTCTTGCTTCTCATGGGTGGG - Exonic
955603016 3:60668472-60668494 GTGACCATCTTCTGTTGGGTTGG + Intronic
956496530 3:69832218-69832240 GCCTCCTCCTTCTGATGGTCTGG - Intronic
957291605 3:78283827-78283849 GTCTCCCACTTCTATTGTGTGGG - Intergenic
957550209 3:81694552-81694574 GGCTTCTGCTTCTGTTGAGTTGG - Intronic
959596537 3:108135281-108135303 GTTTCCTCCTTCTGTTGGCCTGG + Intergenic
960040653 3:113147146-113147168 GTGTTTTCCTTCAGTTGGGTAGG + Intergenic
960048450 3:113219113-113219135 GTGTGCTCCTTCTCTTGGGAGGG - Intronic
961835459 3:129654625-129654647 GTCTTCTCCTTCTGTGGGAAAGG - Intronic
962087629 3:132208532-132208554 GTCTCTTTCTGCTGTTGGTTTGG - Intronic
963801367 3:149679204-149679226 CTCTCTGACTTCTGTTGGGTTGG + Intronic
963925580 3:150947442-150947464 GTCTCCTACTACTATTGTGTGGG - Intronic
964396560 3:156252025-156252047 GTTTCCTCCTGCTGATGAGTTGG + Intronic
967003316 3:185358122-185358144 TTCTCTTCCTTGTTTTGGGTTGG - Intronic
968053922 3:195676309-195676331 GTCTCCTCCCTCTGTTGCCCAGG - Intergenic
968101969 3:195972844-195972866 GTCTCCTCCCTCTGTTGCCCAGG + Intergenic
969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG + Intronic
969569222 4:7998747-7998769 GCCACCTCCTGCTGCTGGGTGGG + Intronic
969815070 4:9680817-9680839 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
973027460 4:45291003-45291025 GTCTCCTACTACTATTGTGTGGG + Intergenic
973530094 4:51828507-51828529 GTCTTCTACTACTGTTGTGTGGG + Intergenic
976359073 4:84156313-84156335 GTCTGCTCCATGAGTTGGGTGGG - Intergenic
976378684 4:84374856-84374878 ATCTGCTCTTGCTGTTGGGTAGG - Intergenic
977883760 4:102235601-102235623 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
979781498 4:124656785-124656807 GTCACCTCTATCAGTTGGGTGGG - Intergenic
979805998 4:124972054-124972076 GTCTCCCCTTTTTGTTGGGCTGG + Intergenic
980064072 4:128163884-128163906 GGCTCAACCTTCTGTGGGGTGGG - Intronic
980716699 4:136637831-136637853 ATAGCCTCCTTCTGTGGGGTGGG - Intergenic
980886390 4:138767046-138767068 GACTCCACATTTTGTTGGGTGGG + Intergenic
981283452 4:142987983-142988005 GTATTCTCCTGCTGTTGGGTTGG + Intergenic
981975489 4:150723147-150723169 GGCTCCTCCTAGTGCTGGGTTGG + Intronic
983979044 4:173972370-173972392 GTCACCTCTTCCTTTTGGGTTGG + Intergenic
984055779 4:174927988-174928010 GTGGCCTTCTTCTGTTTGGTGGG + Intronic
984147693 4:176083850-176083872 GTTTAGTCCTTCTGTTGGGAGGG + Intronic
985710799 5:1428579-1428601 GCCACCTCCCTCTGGTGGGTGGG + Intronic
986346113 5:6837022-6837044 GTCTCTGCCTTGTGCTGGGTGGG + Intergenic
986626361 5:9726598-9726620 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
986932783 5:12847849-12847871 GTCTCCAACTTTTGTTGGCTAGG - Intergenic
987186903 5:15430741-15430763 GTCTCTTACTACTGCTGGGTTGG + Intergenic
987343366 5:16957715-16957737 GTTTCTTCCTTCTGGTGGGTTGG - Intergenic
987844690 5:23267672-23267694 GTCTCCTGCTTTTGCTTGGTAGG + Intergenic
989256703 5:39373770-39373792 GTTTACTCCTTCTATTGGTTTGG + Intronic
989322558 5:40153724-40153746 CTATCCTCCATCTGTTGGGTGGG - Intergenic
990419138 5:55614712-55614734 GTTTCTTCCTTCTGGTGGGCTGG - Intergenic
990835456 5:60014319-60014341 GTTTCCTATTTCTGATGGGTAGG - Intronic
995326243 5:110893175-110893197 GTTTCTTCCTTCTGGTGGGTCGG + Intergenic
995547352 5:113246399-113246421 TTCCCCTCTTTCTGTGGGGTAGG - Intronic
1000432210 5:161165391-161165413 GTTTCTTCCTTCTGGTGGGTTGG + Intergenic
1002085540 5:176773007-176773029 GTTGCTTCCTTCTGGTGGGTTGG - Intergenic
1002863115 6:1097309-1097331 GCCTCCTCCTTCTGTCGTGCTGG + Intergenic
1005748915 6:28865619-28865641 GTTTCTTCCTTCTGGTGGTTTGG + Intergenic
1008478375 6:51958221-51958243 GTCTCTTCTTTCTCTTGGGGAGG - Intronic
1008725351 6:54411381-54411403 CTCTCAGCCTTCTCTTGGGTAGG - Intergenic
1008758109 6:54822270-54822292 GTCTCCCACTTCTATTGTGTGGG + Intergenic
1009858635 6:69295593-69295615 CTCTCCTTCCTCTATTGGGTGGG - Intronic
1010163166 6:72882795-72882817 GTCTCTGCATTCTGCTGGGTTGG + Intronic
1010357644 6:74952812-74952834 GTCTCCTGCTACTATTGTGTAGG - Intergenic
1013637922 6:112047031-112047053 GTCTCCTTCCTTTGTTGGCTGGG - Intergenic
1013814022 6:114076125-114076147 ATCTGCTCCTTCTGTGGGGCAGG + Intronic
1014240916 6:119016536-119016558 GTTTCTTCCTTCTGGTGGGTTGG - Intronic
1014651631 6:124046716-124046738 GTCTTCTCCATCTGATGAGTGGG + Intronic
1015407675 6:132855852-132855874 GTCAGTTCCTTCTCTTGGGTTGG - Intergenic
1016718103 6:147257847-147257869 GGCTCATAGTTCTGTTGGGTCGG + Intronic
1017041416 6:150311099-150311121 GTTTCTTCCTTCCGGTGGGTTGG + Intergenic
1017738473 6:157383379-157383401 TCCGCCTCCTCCTGTTGGGTAGG + Intronic
1019342464 7:515058-515080 GACTCCTCCTCCAGGTGGGTGGG - Intronic
1021071916 7:16251261-16251283 GTCTCCCCCTATTATTGGGTGGG - Intronic
1021218678 7:17949170-17949192 GTCCCCTCATTCTGAAGGGTGGG - Intergenic
1021639319 7:22722716-22722738 CTCTTCTCCATCTGTGGGGTAGG - Intergenic
1024426024 7:49227367-49227389 GTCTCCTCCTTCTCTCTGGCCGG + Intergenic
1030137195 7:106266026-106266048 AGCTCCTCCTTTTGTTTGGTTGG + Intronic
1034489908 7:151387596-151387618 CTCTCCTGCTTCTGCTTGGTTGG - Intronic
1036161243 8:6390411-6390433 GTTTCTTCCTTCTGGTAGGTTGG - Intergenic
1036440882 8:8780847-8780869 GTTTCTTCCTTCTGGTGGGTTGG + Intergenic
1038164047 8:25067708-25067730 GCTTCCTCCTGCTGTGGGGTGGG + Intergenic
1039120217 8:34137275-34137297 GTCTCCACCTACTGTAGAGTAGG - Intergenic
1039615714 8:38953518-38953540 GTCTCCTCCCTGTGTTAGCTTGG - Intronic
1041935000 8:63324188-63324210 ATGGCCTCCTTCTGTGGGGTGGG - Intergenic
1044520943 8:93198636-93198658 GGCTTCTCCTTCAGTTGGTTTGG - Intergenic
1048808228 8:138260838-138260860 GTCTCCTCCTTCTGTCCTGAAGG + Intronic
1049530524 8:143152251-143152273 GTCTCCTCCTTCCTTTGTGTTGG - Intergenic
1052209031 9:25879247-25879269 GTCACTTTCTTCTGTTGGGTTGG - Intergenic
1053031096 9:34778789-34778811 GTATTCTGCTGCTGTTGGGTGGG - Intergenic
1055537679 9:77266400-77266422 GTCTCCTGCTGTTGTTGTGTGGG + Intronic
1057354339 9:94321894-94321916 GTCTCCTCCAGCTGTGGGGATGG - Intronic
1057653425 9:96935741-96935763 GTCTCCTCCAGCTGTGGGGATGG + Intronic
1060023238 9:120150154-120150176 GTCTCCTCCTTCTCATGGTGGGG + Intergenic
1060573083 9:124661403-124661425 GTCTCCTCCTCCTGTTGAAATGG - Intronic
1185721127 X:2382296-2382318 ATGTCCTCCTTCTGGTGGGTAGG - Intronic
1186023974 X:5288346-5288368 GTTTCTTCCTTCTGGTGGGCTGG + Intergenic
1187283057 X:17876632-17876654 GTTGCCTTCTTCTGCTGGGTAGG + Intergenic
1188702591 X:33282846-33282868 GTCCCCATCTTCTGTTGGATAGG + Intronic
1190042721 X:47084276-47084298 CTCTCTTCCTTCTGTTGAGTAGG - Intronic
1190080740 X:47354964-47354986 GTTGCCTTCTTCTGGTGGGTGGG + Intergenic
1191057791 X:56260830-56260852 GTTTCCTCTTTCTGTTTGGGAGG + Intronic
1192258647 X:69489359-69489381 GTCTATTTCTTCTGTTGGGTGGG - Intergenic
1192471462 X:71402560-71402582 GTCTCATCCATCTTTTGGGATGG - Intronic
1193571912 X:83154184-83154206 GTCTCCTACTACTATTGTGTGGG - Intergenic
1194025349 X:88744841-88744863 ATTTCCACCTTCTGTTGGTTTGG - Intergenic
1194610415 X:96036194-96036216 GTCTCCTTCTGTTGGTGGGTAGG - Intergenic
1195687792 X:107601712-107601734 GTCTCCTTCTTCTGGCGGGTTGG - Exonic
1195739679 X:108050940-108050962 GTTTCTTTCTTCTGCTGGGTGGG - Intronic
1197244620 X:124155217-124155239 GTCTCCACCATCTGGAGGGTGGG + Intronic
1197591150 X:128411722-128411744 GACTCCTCTTTCTGTTGCTTTGG - Intergenic
1198642971 X:138777046-138777068 GTCACCTTGTTCTGTTGGATAGG - Intronic
1199050077 X:143228061-143228083 GTTTCTTCCTTCTGGTGGGTTGG + Intergenic
1200069566 X:153521264-153521286 CTGGGCTCCTTCTGTTGGGTGGG + Intronic
1201968027 Y:19759839-19759861 GTCTCCTACTGTTGTTGTGTGGG + Intergenic