ID: 953514673

View in Genome Browser
Species Human (GRCh38)
Location 3:43578366-43578388
Sequence GGGTCGCTGGGGACTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953514673 Original CRISPR GGGTCGCTGGGGACTGAGAC TGG (reversed) Intronic
901031611 1:6310382-6310404 GGGTGGCTGGGGAATGGGCCTGG - Intronic
901667979 1:10837268-10837290 GGGCCTGTGGGGACAGAGACAGG + Intergenic
901753550 1:11427085-11427107 GGGGCCCTGGGGACTGGGTCAGG - Intergenic
902501320 1:16913674-16913696 TCGTCGCTGGGGGCTGTGACGGG + Intronic
903071740 1:20730197-20730219 GGGTGGCCGGGGACAGAGGCAGG + Intronic
903132326 1:21288458-21288480 GGGTCGCTGGCTTCAGAGACGGG + Intronic
903968980 1:27106929-27106951 TGGTCTCTGGGGACAGAGTCAGG - Intronic
905796626 1:40819652-40819674 GGCTAGCTGGGGACAGAGGCAGG - Intronic
907074864 1:51568957-51568979 GGGTGGCGGGGGGCTGAGGCGGG - Intergenic
907118679 1:51990471-51990493 GGGGCGCTGGGCACCGAGAGCGG - Intronic
907460705 1:54603905-54603927 GGGTCCCAGGGGACGGAGAGGGG - Exonic
907460909 1:54605001-54605023 GGGATGCTGGAGGCTGAGACTGG - Intronic
907518247 1:55006993-55007015 GGGCGGCTGGGGACTGGGGCTGG - Exonic
908760269 1:67505325-67505347 GTGTAGCTGGGGGCTGAGATTGG + Intergenic
910112969 1:83701736-83701758 GGGTCTGTGGGGACTCAGCCTGG - Intergenic
910217042 1:84853398-84853420 GGTCAGCTGGGGAATGAGACAGG + Intronic
912748355 1:112264848-112264870 AGGGAGCTGGGAACTGAGACAGG + Intergenic
914946169 1:152068420-152068442 CGGTGGCTGGGGACTAAGACAGG + Intergenic
915495950 1:156282705-156282727 GGGTGGCAGGGGCCTGTGACCGG - Exonic
915859792 1:159432006-159432028 GGTTCTCTGGGCCCTGAGACTGG - Intergenic
916054610 1:161059711-161059733 GGGGCACTGGGGACACAGACGGG + Exonic
916451880 1:164928611-164928633 GGGTGGTTGGGGACTCATACAGG + Intergenic
917700593 1:177576608-177576630 GGGTGGCTGGGAAATGACACTGG + Intergenic
918365660 1:183805180-183805202 CGGTCGCTCGGGACCGGGACCGG + Intronic
918404752 1:184200823-184200845 GGGAAGCTGGGGAGGGAGACTGG - Intergenic
919746240 1:201010766-201010788 GGGCAGCTGGGGACAGAGACAGG - Intronic
919779546 1:201213228-201213250 GGGTCCCTGGAGGCTGAGAATGG + Exonic
920059189 1:203215946-203215968 AGGCAGCTGGGGACTGGGACAGG - Intronic
920120170 1:203650384-203650406 GGGTCCCTGGGGAGGGAGAGAGG + Intronic
920178422 1:204117554-204117576 GGGTCCCTGGGGACTCACACAGG + Intronic
920495782 1:206454062-206454084 GGGGAGCTGGGGACAGAGACAGG - Intronic
920570837 1:207016149-207016171 GGTTGGGAGGGGACTGAGACAGG - Intronic
921810131 1:219503066-219503088 AGGGTGGTGGGGACTGAGACTGG + Intergenic
922875533 1:228937170-228937192 GGGTGGTTGGGGACTGGCACAGG - Intergenic
1063648285 10:7907919-7907941 GAGTCGATGGGGACTGAATCTGG + Intronic
1065453599 10:25883530-25883552 GGGTGACTGGGGAAAGAGACTGG - Intergenic
1067670561 10:48317284-48317306 GGGAGGCTGGAGGCTGAGACAGG - Intronic
1068965645 10:62909947-62909969 GTGTCGCTGGTGACTCAGAGAGG - Intronic
1069726576 10:70583829-70583851 GAGTAGCTGGGGACTCAGAGGGG + Intergenic
1069881673 10:71597301-71597323 GGGTCCCTGTGGCCTGTGACAGG - Intronic
1069991534 10:72319597-72319619 GGGCCGCTAGGGACTCAGTCTGG + Intergenic
1070519075 10:77236059-77236081 GGGGAGCAGGGGACTGAGGCTGG + Intronic
1071386187 10:85123727-85123749 GGGTGGCTGGAGTCTGAGAATGG + Intergenic
1072567706 10:96631181-96631203 GAGATGCTGGGGCCTGAGACAGG - Intronic
1075745269 10:124723198-124723220 GGGACTCAGGGGACTGAGGCTGG - Intronic
1077089209 11:770821-770843 GGGTCCCTGAAGCCTGAGACGGG + Exonic
1077351536 11:2095325-2095347 GGGCTGCTGGGGACAGAGGCTGG - Intergenic
1078099002 11:8318609-8318631 GTGTCGCTGGGCACTGAAAGTGG + Intergenic
1078660343 11:13280821-13280843 GGGACGATGGGGATAGAGACAGG - Intronic
1078983283 11:16562693-16562715 GGGTCACTGGGGCCAGGGACAGG - Intronic
1079131884 11:17751618-17751640 TGGGAGCTGGGGACAGAGACTGG + Intronic
1079360440 11:19766290-19766312 GGGTGGCTGTGGACTGTGAGAGG + Intronic
1079786917 11:24684784-24684806 GGGGAGCTGGGAAGTGAGACAGG - Intronic
1081246544 11:40773216-40773238 GGGTCACTGGGGAGTGAGAATGG + Intronic
1083176309 11:60952105-60952127 GGGCTGCAGGGGACTGAGAGGGG - Intronic
1083885825 11:65573007-65573029 GGAACGCAGGGGACTGGGACAGG + Intronic
1088814198 11:113410372-113410394 GGGTTGCTGGAGCCTGAGTCAGG - Exonic
1091936803 12:4441322-4441344 GGGTCGCGGAGCCCTGAGACGGG + Intronic
1102212774 12:111139017-111139039 GGTTCTCTGGGGGCTGAGATGGG - Intronic
1102452512 12:113052459-113052481 GTGTCTCTGGGGACTGAAATGGG - Intergenic
1102492366 12:113297049-113297071 GGGTGGCTGGGAACTGGGCCGGG - Exonic
1102662967 12:114545731-114545753 GGGTGCCTGGGGACCAAGACTGG + Intergenic
1102665085 12:114564931-114564953 GGGTGCCTGGGGACCAAGACTGG - Intergenic
1104137626 12:125955589-125955611 GCGACTCTGGGGGCTGAGACTGG - Intergenic
1106304849 13:28500547-28500569 GGGTTGCAAGGGAATGAGACTGG + Intergenic
1109436243 13:62307243-62307265 TGGTCAGTGGGGAATGAGACTGG + Intergenic
1113212122 13:107995392-107995414 GGGTGGCTGGGGACAGAAGCTGG - Intergenic
1113461451 13:110485093-110485115 GCGTCTCTGGGGACGGAGAAGGG - Intronic
1113850402 13:113414421-113414443 GGGAGGCTGGGGACTGAGGGAGG - Intergenic
1117015619 14:51514193-51514215 AGGTCGCTGGGTAGAGAGACAGG + Intronic
1117647181 14:57865297-57865319 GGGGCGCTGGGGACGCAGGCTGG - Intronic
1118157680 14:63257279-63257301 GGGATGCTGGGGACTGGGTCGGG - Intronic
1119706077 14:76783322-76783344 GGACTGCTGTGGACTGAGACTGG - Intergenic
1120288576 14:82537261-82537283 TGGTCTCTGGGAACTGAGAGTGG + Intergenic
1122141244 14:99664236-99664258 GGGGCTCTGGGCACTGAGCCGGG - Intronic
1123721639 15:23066210-23066232 AGGCCGCTGGGAGCTGAGACCGG - Intergenic
1124558112 15:30746470-30746492 GGGTGGATGGAGAATGAGACTGG - Intronic
1124670583 15:31634905-31634927 GGGACCCTGGGGACGCAGACAGG + Intronic
1124673137 15:31659179-31659201 GGGTAGATGGAGAATGAGACTGG + Intronic
1126903740 15:53342430-53342452 GGGAGGCTGAGGACTGAGACAGG - Intergenic
1127877259 15:63122063-63122085 GGGCCGCGGGGGACTGCGCCGGG - Exonic
1129169981 15:73801709-73801731 GGGTAGCTGGGTAGTGAGACAGG + Intergenic
1131827794 15:96334017-96334039 GGGAACCTGGGGACTGAGGCTGG + Intronic
1136895326 16:33992981-33993003 GGGCAGCTGGGGGCTGAGGCAGG - Intergenic
1137293247 16:47066472-47066494 GGGTCCCTGGGCACTGGGTCGGG + Intergenic
1137622227 16:49883584-49883606 GGCACCCTGGGGGCTGAGACAGG - Intergenic
1138044297 16:53704573-53704595 TGGTCTCTGAGGACTGAGATCGG + Intronic
1138589172 16:57990325-57990347 GAGTCCCTGGAGACTGAGAGGGG - Intergenic
1139244845 16:65431719-65431741 GGGGCGCTGCGGTGTGAGACAGG - Intergenic
1140415924 16:74774147-74774169 GGGGGGCTGGGGACAGAAACGGG + Intronic
1140528504 16:75644341-75644363 GGGTCACAGGGAACTGCGACTGG - Exonic
1141139817 16:81490013-81490035 GGGTCCCTGGGGAGTGAGAGGGG + Intronic
1141903701 16:87008882-87008904 GGGGCGCTGGGGATTGACACGGG + Intergenic
1141949655 16:87332363-87332385 GGTTAGCTGGGGACGGAGGCTGG + Intronic
1142242020 16:88951870-88951892 GGGTCTGTGGGGCCTGAAACCGG + Intronic
1142434170 16:90046717-90046739 GGGTCACAGGGGCCTGAGGCTGG + Intergenic
1142547498 17:714894-714916 GGATCACGGCGGACTGAGACTGG + Intronic
1143184480 17:5001967-5001989 GGGTCACTTGGGACTGGGCCTGG + Intronic
1143863375 17:9907101-9907123 GCTTCTCAGGGGACTGAGACAGG - Intergenic
1146313351 17:31788141-31788163 GGGTCACAGGGGAATGAAACAGG + Intergenic
1146723897 17:35142183-35142205 GGGTCCCTGAGGCCTGAGAGAGG - Intronic
1147564865 17:41529829-41529851 GGGTCACTGGGGACAGGAACTGG - Intergenic
1150225148 17:63520591-63520613 GGGTTGCTGGGCATTGAGCCAGG + Intronic
1150299449 17:64036328-64036350 ATGGGGCTGGGGACTGAGACAGG - Intergenic
1151305064 17:73257921-73257943 CAGCCGCTGGGGACTGAGTCAGG - Intronic
1151623918 17:75264789-75264811 GGGTGGGCAGGGACTGAGACAGG - Intronic
1151947289 17:77326537-77326559 GGGGCGCGGGGGGCTGAGGCCGG + Intronic
1152235270 17:79135307-79135329 GGGTCCCTGGGGAAGGAGCCAGG + Intronic
1152520797 17:80855526-80855548 GGGTCCCTGGGCAGTGAGCCTGG + Exonic
1152741341 17:82019803-82019825 GGGTCCCTGAGGACAGACACGGG + Intronic
1152759531 17:82100716-82100738 GGGGTGCGGGGGACAGAGACTGG + Intergenic
1153335400 18:3918794-3918816 GGGTGGCTGGAGGCAGAGACTGG + Intronic
1153951296 18:10059865-10059887 GGCTTGCTGGGAACTGAGGCTGG + Intergenic
1155831599 18:30522451-30522473 GTGACTCTGGAGACTGAGACAGG - Intergenic
1156901183 18:42302105-42302127 GGGTGTGTGGGGAGTGAGACTGG - Intergenic
1157302047 18:46486128-46486150 TGGTCCCTGGGGAGTGAGCCTGG - Intronic
1159040725 18:63320533-63320555 TGGTCGCTGGGGTCCGCGACGGG + Intergenic
1160337013 18:78051181-78051203 GGGTGGTTGGGGAAGGAGACTGG + Intergenic
1160822429 19:1064781-1064803 GGGTGGCGGGGGACTGAGACGGG + Intronic
1160916087 19:1497381-1497403 GGGTGGCCGAGGACTGGGACTGG - Exonic
1161012504 19:1967467-1967489 GGGTGGCTGGGGCCTGGGTCAGG + Intronic
1161227736 19:3154977-3154999 GGGGCTCTGGAGACTGAGACGGG - Intronic
1161347942 19:3777402-3777424 GGATGGCTGGGGCCTGAGAAAGG + Intergenic
1161418174 19:4159634-4159656 GGGCAGGTGGGGACGGAGACAGG - Intronic
1162296952 19:9819732-9819754 GGGGAGCGGGGGACGGAGACAGG + Intronic
1163831728 19:19550354-19550376 GGGTCGTGGGGGGTTGAGACTGG - Intergenic
1165898305 19:39156316-39156338 GGGTGGCTGGGGAGTGACAGGGG - Intronic
1166663940 19:44665897-44665919 GCGGCGCTGGTGAATGAGACCGG - Intronic
1167418443 19:49389435-49389457 GGGTCTGACGGGACTGAGACGGG - Intronic
1167429659 19:49447228-49447250 GGGGCCCTGGGCACTGAGAGAGG - Intronic
1167449715 19:49560034-49560056 AGGCCGCTGGGGACAGAGATGGG + Exonic
1167571926 19:50293711-50293733 AGGTCAATGGGGACTGAGGCTGG - Intronic
1167788021 19:51651681-51651703 GGGTGGCTGGGGACCCAGGCTGG - Intergenic
1168555844 19:57339246-57339268 GGATGGCTGAGGACTGAGCCTGG - Intergenic
925703729 2:6664448-6664470 GGGGTGCTGGAGACTGAGAGAGG - Intergenic
926226584 2:10971276-10971298 GTGTCGCTGGAGACTCAGACAGG + Intergenic
926343179 2:11921742-11921764 GAGTCTCTTGGGACAGAGACGGG - Intergenic
926373271 2:12202044-12202066 GGGTTGCTGGGGAGAGAGGCAGG + Intergenic
926735633 2:16071234-16071256 GGGGCGGTGGGGAGTGACACTGG + Intergenic
927809443 2:26173339-26173361 GGGTCGCTGGAGATGGGGACCGG + Intronic
929670973 2:43876244-43876266 GGGTTGCTGGGGACATGGACTGG - Intronic
930212396 2:48654492-48654514 GCTTCGCGGGAGACTGAGACAGG - Intronic
930304979 2:49666147-49666169 GGGTGGCTGGAGACTCAGGCTGG + Intergenic
932593917 2:73082674-73082696 GGGACTCTGGGGACGGGGACAGG + Intronic
936638416 2:114285323-114285345 GGGTCCCTGGGGGATGAGATAGG - Intergenic
938091601 2:128438173-128438195 GGGTGGCGGGGGACGGAGATGGG - Intergenic
938397234 2:130960746-130960768 GGATCTCTGGGGACAAAGACTGG - Intronic
939227301 2:139380071-139380093 AGGTGGGTGGGGACTGAGATGGG - Intergenic
945985734 2:216352183-216352205 AGGTTGCTGGGGACTAAAACAGG - Intronic
946411921 2:219519802-219519824 GGGTAGCTGCGGGCTGTGACTGG + Intronic
947592975 2:231395705-231395727 GGGCGGGTGGGGACGGAGACCGG - Exonic
948087631 2:235264745-235264767 GGGCCGCTGGGCACTGGGAAGGG + Intergenic
948118477 2:235511361-235511383 GGTTCCCTGGGGTCTGAGCCAGG + Intronic
948205683 2:236161698-236161720 GGGTCTCTGGGGACAGAAATAGG + Intergenic
948615848 2:239198348-239198370 GGTTCTCTGGGCACTGAGCCAGG - Intronic
1172131434 20:32658739-32658761 GGGTAGGTGGGGAATGACACTGG + Intergenic
1174510907 20:51051719-51051741 TGCTGGCTAGGGACTGAGACAGG + Intergenic
1175215543 20:57390221-57390243 GGGTCTGTGGGGACTGGGAGTGG - Intergenic
1175913238 20:62414401-62414423 GGGTCGCTGGGGGCTGCAGCAGG + Exonic
1176000722 20:62830208-62830230 GGGTTGCTGGGGACAAAGGCAGG - Intronic
1176141399 20:63546637-63546659 TGGGGGCTGGGGGCTGAGACAGG - Intronic
1177386176 21:20412130-20412152 AGGTTGCTGGTGACTGACACTGG - Intergenic
1177457170 21:21355348-21355370 GGGTTGCAGGGGGCTGAGGCAGG + Intronic
1178005944 21:28219654-28219676 GGGTGGCTGGGGAAAGAGGCTGG + Intergenic
1178453762 21:32728156-32728178 AGGTAGCTGGAGACTGAGGCTGG - Intergenic
1178907167 21:36646354-36646376 GGATCCCTGAGGACAGAGACTGG - Intergenic
1179388716 21:40967888-40967910 GCAGCACTGGGGACTGAGACCGG + Intergenic
1180095465 21:45553998-45554020 GGGGCGCGGGGGACTGGGAGGGG - Intergenic
1180095483 21:45554039-45554061 GGGGCGCGGGGGACTGGGAGGGG - Intergenic
1180095565 21:45554203-45554225 GGGGCGCGGGGGACTGGGATGGG - Intergenic
1180095670 21:45554424-45554446 GGGGCGCGGGGGACTGGGATGGG - Intergenic
1180183029 21:46126451-46126473 GGTTCGCTAGGGACTGACCCTGG + Intronic
1181001214 22:19988619-19988641 AGGTAGCTGGGGGCTGAGGCTGG - Intronic
1181422558 22:22811849-22811871 GGGTCTATGGGCACTGAGCCTGG - Intronic
1182109306 22:27711492-27711514 AGGTCACTGGGGACTGAGACTGG + Intergenic
1183351213 22:37335668-37335690 TGGTCCCTGGGGAATGAGCCGGG + Intergenic
1184070100 22:42142099-42142121 AGATGGCTGGGGCCTGAGACTGG - Intergenic
1184071842 22:42151705-42151727 AGGCAGCTGGGGCCTGAGACTGG - Intergenic
1184286256 22:43473436-43473458 GGGTGGATGGGGACCCAGACAGG - Intronic
1184289814 22:43492650-43492672 GGGGGCCTGGGGAATGAGACTGG - Intronic
1184997369 22:48218191-48218213 GATTTGCTGGGGAGTGAGACAGG - Intergenic
950575548 3:13830128-13830150 GGGTGGCTGGGGTCTGAGCATGG - Intronic
952887219 3:38019131-38019153 AGGTCTATGGGGAGTGAGACTGG - Intronic
953038752 3:39236564-39236586 GGGTGGCTGGGGACAGGGATGGG - Intergenic
953514673 3:43578366-43578388 GGGTCGCTGGGGACTGAGACTGG - Intronic
961667339 3:128501253-128501275 GGGTGGCTGGGGACAGGGATGGG + Intergenic
966926030 3:184645244-184645266 GGGTAGTTGGGGGCTGAGATGGG - Intronic
968414403 4:417861-417883 GGGTCCCTGGGGCTTGTGACTGG + Intergenic
968697996 4:2042129-2042151 GGCTCGCTGGGCCCGGAGACCGG + Intronic
969571315 4:8010360-8010382 GGCGGGCTGGGGACGGAGACGGG - Intronic
972844076 4:42966348-42966370 GGGTCTCTGGTGACAGAGAGAGG + Intronic
977323598 4:95548809-95548831 GGCCCGCTGCGGACTGGGACTGG - Exonic
982717870 4:158827812-158827834 GGGGCGGTGGGGACTGAAAATGG - Intronic
984060188 4:174981248-174981270 GGGTGGCTGGGGAAAGAGGCTGG + Intergenic
984805681 4:183749237-183749259 GGTAAGCTGGGAACTGAGACAGG - Intergenic
985530827 5:433139-433161 GTGTCGCTGGGGACTGACCCCGG + Intronic
986975667 5:13390465-13390487 TGGGCACTGGGGACTAAGACGGG + Intergenic
990874552 5:60469328-60469350 GGGGAGCTGGTGACTGAGACTGG - Intronic
991003558 5:61806333-61806355 GGGTGGCTGGGGACAGGGACAGG + Intergenic
1001537492 5:172508485-172508507 GGGGCCCTGAGGACTGAGAGTGG + Intergenic
1002394097 5:178940081-178940103 GGGTCCCTGGGAACTGCTACAGG + Intergenic
1002434673 5:179223913-179223935 GGGTACCTGGGGACTTAGAGAGG - Intronic
1006123480 6:31822068-31822090 GGGCCGCTGGGGCCTGAGGGCGG - Intergenic
1007318253 6:41007516-41007538 GGGTCCTTGGGGGCTGAGGCAGG - Intergenic
1007919941 6:45597912-45597934 GAGTCCATGGGTACTGAGACAGG - Intronic
1008126091 6:47670416-47670438 GGGTGGCTGGGAACTTGGACTGG - Intronic
1012363442 6:98410642-98410664 GGGTCTCAGAGGACTCAGACTGG - Intergenic
1012920684 6:105218763-105218785 GGGTGGCTGGGGAAAGAGGCTGG + Intergenic
1013557621 6:111272614-111272636 GGGTGGCTGAGGAATGAGAATGG - Intergenic
1013647924 6:112163565-112163587 GGGTCGCTGGTGACCTGGACAGG + Intronic
1016834719 6:148465796-148465818 AGTTGGCTGGGGACTGAGGCAGG - Intronic
1019506773 7:1395304-1395326 TGGGTGCTGGGGGCTGAGACTGG - Intergenic
1019518308 7:1449181-1449203 GGGCCGCTAGAGGCTGAGACAGG + Intronic
1019927534 7:4203145-4203167 TGGGCGCTGGGGCCTGAGCCGGG - Intronic
1020003564 7:4769331-4769353 GGGTCACTGGGGCCTGAAGCGGG - Exonic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1021040202 7:15852831-15852853 GGTTCCCTAGGGACTGAGGCTGG - Intergenic
1022318624 7:29267048-29267070 GGGTGGGTGGGGCTTGAGACAGG - Intronic
1022517332 7:30984291-30984313 GGCTCTCTGGGGACAGAGAATGG - Intronic
1023805327 7:43869203-43869225 GTGTCGCTGGGGTCCGAGGCGGG - Intronic
1024908440 7:54416826-54416848 TGGTTGCCAGGGACTGAGACTGG + Intergenic
1027183454 7:75955493-75955515 GGGCCCCTGGAGTCTGAGACTGG - Intronic
1028137265 7:87235000-87235022 GGGGAGCTGGGAACTGAGATAGG - Intergenic
1028273608 7:88823658-88823680 TGGTACCTGGGGACTGAGAAGGG - Intronic
1031990239 7:128192769-128192791 AGCCCGCTGGGGACTGGGACGGG - Intergenic
1032335169 7:131018365-131018387 GGGTAGGTGGTGGCTGAGACAGG - Intergenic
1033430032 7:141280811-141280833 GGGTCTCGGGGGAATGACACAGG + Intronic
1033582356 7:142749538-142749560 GGGTGGTTGGGGCCTGAGGCAGG - Intronic
1037154721 8:15685301-15685323 GAGTCGCTGGGCACTAGGACCGG - Intronic
1038616748 8:29102544-29102566 GGGTCCCTGGGGACCAAGTCAGG - Intronic
1041719764 8:60965316-60965338 GGGCCTCTGGGGGCTGAGGCAGG + Intergenic
1042012251 8:64260369-64260391 GGATCCCTGGGGGTTGAGACTGG - Intergenic
1044844596 8:96367650-96367672 GGGTTGCCAGGGGCTGAGACGGG - Intergenic
1046590909 8:116205856-116205878 TGGTCACTGGGTACTGAGAAAGG - Intergenic
1049159671 8:141089214-141089236 GGGACGCTGGGGTCTGAGCCGGG - Intergenic
1049264587 8:141660646-141660668 TGGACGCTGGGGCCAGAGACAGG - Intergenic
1049607418 8:143536220-143536242 GGGGCGCTGGGCACTGGGGCTGG - Intronic
1049998340 9:1051581-1051603 GCTTCGCTGGGGCCTGAGCCTGG - Exonic
1052424850 9:28291106-28291128 GGTAAGCTGGGAACTGAGACAGG - Intronic
1052901101 9:33795627-33795649 GGGTGGGTGGGGCCTGAGGCAGG - Intronic
1053305602 9:36982417-36982439 GGCTCCCTGAGGGCTGAGACTGG - Intronic
1057445385 9:95111057-95111079 GGGCTGCTGGGGAGCGAGACAGG + Intronic
1057523981 9:95783688-95783710 GGGGCGCTGAGAACAGAGACGGG + Intergenic
1060293691 9:122328396-122328418 TGGTTGCTGGGGGCTGAGAAGGG - Intergenic
1060321822 9:122568942-122568964 AGGTTGCTGGGGAGTCAGACTGG + Intergenic
1060969578 9:127730474-127730496 GGGTCGCTGGGGGCTGGGCGGGG + Intronic
1060999680 9:127896150-127896172 TGGTGGCTGGGGTCTGAGACAGG + Intronic
1061244039 9:129392135-129392157 GGGTGGGTGGGGACAGAGGCGGG + Intergenic
1062113789 9:134796831-134796853 GGGTCCCTGGGAACAGAGAAAGG - Exonic
1062273488 9:135720236-135720258 GGGTAGCTGGGAACAGAGAGAGG + Intronic
1062657821 9:137613326-137613348 GTGGCGCTGGTGACTGAGACAGG + Intronic
1062713065 9:137987231-137987253 GGGTCACTGGGATCTGAGATAGG - Intronic
1187045679 X:15646295-15646317 AGGTCGCTGGTCACTGAGCCCGG + Intronic
1188834821 X:34943421-34943443 GGGAAGCTGAGGACGGAGACGGG - Exonic
1189288121 X:39866517-39866539 GAGACGCTGGGGAGTGAGAGTGG + Intergenic
1189391736 X:40582030-40582052 GGAGTGATGGGGACTGAGACTGG + Intronic
1189695301 X:43656105-43656127 GGGGAGCTGGGCACTGAGAGCGG - Intronic
1193248499 X:79259608-79259630 GGGTCCCTGGGGACTCAGAGGGG + Intergenic
1194235031 X:91372533-91372555 GGGTCACTGGGGAGACAGACTGG - Intergenic
1195202617 X:102565100-102565122 TTGTCCCTGGGGACTGAGGCAGG - Intergenic
1195824987 X:108990063-108990085 CGGGAGCTGGGGTCTGAGACTGG + Intergenic
1198949336 X:142053085-142053107 TGGACTCTGGGGACTGAGAGGGG - Intergenic
1200104630 X:153705526-153705548 GGGCAGCTGGGGGCTGAGGCAGG - Intronic