ID: 953517712

View in Genome Browser
Species Human (GRCh38)
Location 3:43612429-43612451
Sequence GTGGTATCCCTGAGAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953517712_953517716 11 Left 953517712 3:43612429-43612451 CCTGCCTTTCTCAGGGATACCAC 0: 1
1: 0
2: 1
3: 18
4: 165
Right 953517716 3:43612463-43612485 TTACCAAGCTTGCAAAATAGTGG 0: 1
1: 0
2: 0
3: 9
4: 143
953517712_953517718 22 Left 953517712 3:43612429-43612451 CCTGCCTTTCTCAGGGATACCAC 0: 1
1: 0
2: 1
3: 18
4: 165
Right 953517718 3:43612474-43612496 GCAAAATAGTGGAGCCAAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953517712 Original CRISPR GTGGTATCCCTGAGAAAGGC AGG (reversed) Intronic
900506900 1:3033925-3033947 GAGGCATCCCTGAGAGACGCTGG + Intergenic
901017838 1:6242039-6242061 GTGGTGGCCCTGGGAACGGCGGG + Intergenic
902492059 1:16790084-16790106 GAGGCATCCCTGAGAGAGGGAGG - Intronic
903165718 1:21519092-21519114 GGGGTCTCCCTCAGCAAGGCTGG - Intronic
903400630 1:23043785-23043807 GTGGTAACACAGAGAAAGGCAGG - Intronic
906729803 1:48071221-48071243 GCTCTACCCCTGAGAAAGGCAGG + Intergenic
909138220 1:71829408-71829430 GTGGTATCTCTGAAAAAGACTGG - Intronic
909172797 1:72316855-72316877 GAGGTATCCTTGGGAAAGGATGG + Intergenic
912384744 1:109265721-109265743 GTGGTTCTCCTGAGAAAGGAGGG - Exonic
912852674 1:113140739-113140761 ATGGTATCTCTGAGAAATGGTGG - Intergenic
914680333 1:149934447-149934469 GGGATAACCCTGAGCAAGGCTGG - Exonic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
917237019 1:172904820-172904842 CTGATATCCCTGAGGAAGGAAGG - Intergenic
918558982 1:185841731-185841753 GTGGTAGCCCTTAAAGAGGCTGG + Intronic
920111861 1:203592577-203592599 GTGAAATCCCTAAGTAAGGCTGG + Intergenic
920265094 1:204715713-204715735 GGGGGATCCCTGAGAAACGCTGG - Intergenic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
920766644 1:208840032-208840054 GTGGTTGCCCTGTGAAAGGCAGG + Intergenic
921446026 1:215248457-215248479 GTGTGATCCCTGTGAAAGGAGGG + Intergenic
921519432 1:216141343-216141365 GTGGGCTCCCTGGGGAAGGCTGG + Intronic
921574061 1:216813671-216813693 ATGACATCCCTGAAAAAGGCAGG - Intronic
921829555 1:219711749-219711771 GTGGTATCTTGGAGGAAGGCAGG + Intronic
923330674 1:232921249-232921271 ATGCTATCCATGAGTAAGGCTGG - Intergenic
923528387 1:234792453-234792475 GAGGCATCCCTGAGAGAGGGAGG + Intergenic
1063447118 10:6126334-6126356 GGGGTTTCCCGGAGAAGGGCTGG - Intergenic
1063961332 10:11307830-11307852 GGGGCATCACTGAGAAAGGCAGG - Intronic
1070842427 10:79496511-79496533 GTGTTAGCCCTGAGCAGGGCAGG - Intergenic
1072561990 10:96585840-96585862 GTGGTAGACTTGAGCAAGGCAGG - Intronic
1073958230 10:108896563-108896585 GGGGTTTCTTTGAGAAAGGCAGG - Intergenic
1074051419 10:109884261-109884283 GTGGAATCGCACAGAAAGGCTGG + Intronic
1076592026 10:131589987-131590009 GGGGTATCCCTGAGAGAGGAGGG + Intergenic
1076648641 10:131971845-131971867 GGGATGTCCCTGAGAAAGCCTGG + Intronic
1077479765 11:2808085-2808107 GTGGTGTCCATGAGAGGGGCGGG - Intronic
1078559117 11:12355275-12355297 TTGGGATCCCAGAGAAAGGCGGG + Intronic
1078618824 11:12889330-12889352 GTGGTTTTCCTGATAAAGCCTGG + Intronic
1078945073 11:16056612-16056634 GTGGAATCCCAGGCAAAGGCAGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1087378027 11:97368247-97368269 GTGAACTCCCTCAGAAAGGCAGG + Intergenic
1088173439 11:107022101-107022123 GTGCTTTCTCTGAGAAAGACTGG + Intergenic
1089369375 11:117944146-117944168 GAGGTAAACCAGAGAAAGGCAGG + Intergenic
1091249521 11:134130810-134130832 CAGGTATCCCCCAGAAAGGCTGG - Intronic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1094791733 12:33922773-33922795 GTGGCATCCCTGAAAAAGATGGG - Intergenic
1096514497 12:52148548-52148570 CTGGTCTACCTGAGAAAAGCAGG - Intergenic
1097168446 12:57098626-57098648 GTGGTGTCCAGGAGAAGGGCTGG - Intronic
1098167145 12:67710325-67710347 GTGGAAGCCCTGAGAAACGCAGG + Intergenic
1098606185 12:72393431-72393453 GAGCTATCCTTGAGAAATGCAGG + Intronic
1102803959 12:115762968-115762990 GTGTCTTCCGTGAGAAAGGCTGG - Intergenic
1104468057 12:129005920-129005942 TTGCCACCCCTGAGAAAGGCCGG - Intergenic
1104492263 12:129204553-129204575 CTGGTATCCCTGAAAGAGACAGG + Intronic
1107818357 13:44264367-44264389 GGGATTTCCCTGAAAAAGGCTGG - Intergenic
1108520263 13:51240816-51240838 TTGGGATCCCTGAGAAGAGCAGG - Intronic
1108604982 13:52028774-52028796 TTGGTATACATGAGAGAGGCTGG + Exonic
1109282152 13:60369312-60369334 GTGGTAACACTGAGAATTGCAGG - Intergenic
1110347933 13:74470154-74470176 GTGGTATCTTGGAGAGAGGCTGG + Intergenic
1112887870 13:104195665-104195687 GTGCTATCACAGAGGAAGGCAGG - Intergenic
1113729285 13:112628086-112628108 GAGGCAGCCCTGAGCAAGGCTGG - Intergenic
1113859602 13:113472708-113472730 TTGGCAGCCCTGAGCAAGGCTGG + Intronic
1114058809 14:19000500-19000522 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1114103735 14:19401254-19401276 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
1114854915 14:26427130-26427152 GTGTTATCACTGGAAAAGGCTGG + Intergenic
1115752694 14:36507151-36507173 GGGGTCTCCCTGAGGAGGGCAGG + Intronic
1121452703 14:94019498-94019520 GTGGTCAGCCTGGGAAAGGCAGG + Intergenic
1121699240 14:95939685-95939707 GTGATATGTCTGTGAAAGGCTGG - Intergenic
1127221940 15:56889071-56889093 GTGGTATCAATGAGAAAGAAGGG - Intronic
1130954375 15:88616519-88616541 GTGGTTTCCCTAAGAAAGAAGGG + Intergenic
1132474435 16:126617-126639 CTGGTGTCCCTCAGAAAGGCTGG - Intronic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1132617968 16:851751-851773 GGGGTCTCCCTGAGCAGGGCTGG + Intergenic
1135875587 16:26197020-26197042 GTGGGCTACCAGAGAAAGGCAGG - Intergenic
1136251498 16:29008516-29008538 CTTGGATCCCTGAGAAAGACAGG + Intergenic
1138621039 16:58211583-58211605 GTGGAATCTCTGAGTATGGCAGG + Intergenic
1140431945 16:74911643-74911665 GTGTTATCCTAGAGACAGGCTGG - Intronic
1141606716 16:85158241-85158263 GGGGTATGCCTGGGACAGGCAGG + Intergenic
1142620246 17:1161054-1161076 CTTGTATCCCTGAGAAGGGATGG - Intronic
1142712912 17:1733046-1733068 GTAGTGTCCCTGGGGAAGGCAGG + Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1147339567 17:39745589-39745611 GTGGGATCCCTGAAATAGGAGGG + Intronic
1148091782 17:45026791-45026813 GTGGTCTCCCTGATGAAGGCTGG - Intronic
1153668785 18:7391031-7391053 GTGGTTTCCCTGAGAAAGAATGG + Intergenic
1154322827 18:13368399-13368421 CAGGCATCCCTGAGACAGGCCGG - Intronic
1155940278 18:31795674-31795696 GTGGTGTCTTTCAGAAAGGCTGG + Intergenic
1156885590 18:42131841-42131863 CTGCTATGCCTGAGAATGGCAGG + Intergenic
1159332448 18:67015385-67015407 GTGGGATCCCTGAGGAAGAAAGG - Intergenic
1168173069 19:54602554-54602576 GTGGGGTCCATGGGAAAGGCTGG - Intronic
1168578735 19:57535612-57535634 CTGTAATTCCTGAGAAAGGCAGG - Intronic
925716648 2:6790265-6790287 GTCTTATCTCTGGGAAAGGCAGG + Intergenic
926158570 2:10472204-10472226 GGGGTAACCTAGAGAAAGGCTGG + Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
927594076 2:24381731-24381753 GAGGTAGCCCTGAGATAGCCTGG - Intergenic
935445363 2:103150766-103150788 GTGGTACCTCTGAGCATGGCTGG - Intergenic
935861621 2:107337308-107337330 GTGGTATCCTCTAGAGAGGCAGG + Intergenic
938282386 2:130073717-130073739 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938333016 2:130462289-130462311 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938356793 2:130658382-130658404 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
938433229 2:131265188-131265210 TTGGTCTCCCTGAGAGTGGCTGG + Exonic
941310227 2:163919383-163919405 GTGGTATCATGGACAAAGGCTGG - Intergenic
942827865 2:180202308-180202330 GTAACATCCCTGAGAAAGACAGG - Intergenic
943731213 2:191305484-191305506 CTGGGATCCCTGGGACAGGCTGG - Intronic
945472466 2:210242544-210242566 GAGGTATACCTGAGCAGGGCAGG - Intergenic
1168876299 20:1174457-1174479 GCGGGATCCCTGAGAAGGGCTGG + Intronic
1169648453 20:7840792-7840814 GTGGTTTCCTTGGGAAAGTCTGG - Intergenic
1171186876 20:23129111-23129133 GAGGTCTCCCTGAGGGAGGCAGG + Intergenic
1171882688 20:30630250-30630272 TTGGTCTCCCTGAGAGCGGCTGG - Intergenic
1173440622 20:43071953-43071975 GCAGTATGCCTGAGATAGGCTGG - Intronic
1173618172 20:44416245-44416267 GGGGCATCCCTGGGAAAGTCGGG + Intronic
1175710821 20:61219356-61219378 GTGGGTTCCCTGAGCCAGGCTGG + Intergenic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1179728108 21:43351729-43351751 GGGGTTTCCTTGGGAAAGGCAGG - Intergenic
1180477294 22:15723116-15723138 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1181584849 22:23847553-23847575 GTGGTGTCACTGTGAAAGGATGG - Intergenic
1182521023 22:30884616-30884638 GTGGCATCCCTGGGGCAGGCTGG + Intronic
1183401169 22:37605520-37605542 GAGGAACCCCTGAGAAGGGCAGG - Intergenic
1184561193 22:45263800-45263822 CTGGGATCCCAGAGCAAGGCTGG + Intergenic
949106879 3:210391-210413 GTGGTATCTCAGAGAGTGGCTGG + Intronic
949361558 3:3237587-3237609 GTTGTGTGCCTGGGAAAGGCTGG - Intergenic
952106013 3:30070073-30070095 TTGGTAGCCCTGAGTTAGGCAGG - Intergenic
953225263 3:41013125-41013147 ATGGTATCACTGAGAAGGGAAGG - Intergenic
953376506 3:42432767-42432789 GTGATGTCCGTGAGAAAGGGTGG - Intergenic
953414321 3:42706980-42707002 GGGCTATGCCTGAGAAAGGAAGG - Intronic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
953662063 3:44898730-44898752 GTGGTATGCCTCATAAATGCTGG + Intronic
954814582 3:53270521-53270543 TGGGTTTCCCTGAGCAAGGCTGG + Intergenic
956371962 3:68572447-68572469 GTGGTATCCCTGAAAGAGATGGG + Intergenic
956763940 3:72468165-72468187 GTGTTATTCCTGAGAAAGCCTGG - Intergenic
959407393 3:105977114-105977136 GTGATATCCCTTAGATAGGAAGG + Intergenic
962994635 3:140613570-140613592 GTGGTTCCCCAGAGAAAGACTGG - Intergenic
966983908 3:185162478-185162500 TTGGTACCCCTAAGGAAGGCAGG - Intergenic
973178533 4:47239867-47239889 GTGGCAGCAGTGAGAAAGGCCGG - Intronic
973366364 4:49212689-49212711 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
973729662 4:53811148-53811170 GCAGTTTGCCTGAGAAAGGCGGG + Intronic
974467573 4:62276756-62276778 GTGATAACCCAGAGAAAGCCTGG + Intergenic
974564603 4:63566902-63566924 GTGGTGTCCTTGGGAAAGGATGG - Intergenic
975053556 4:69897997-69898019 ATTGTATCCCTGAGAAAAGATGG + Intergenic
982798404 4:159672771-159672793 GTGGTATGCCTGAGAAAACTTGG + Intergenic
986037235 5:3951859-3951881 GTGGTATCCTTGGGGAAGGATGG + Intergenic
990532440 5:56687817-56687839 GGGGTTTTCATGAGAAAGGCAGG - Intergenic
992084459 5:73265506-73265528 ATGGTATCCCTGGGCAAGGGTGG + Intergenic
994597847 5:101861737-101861759 CTGGTGTCCCTGAAAAAGACAGG + Intergenic
996163687 5:120198426-120198448 GTGGTTTACCTGAGACAGACAGG + Intergenic
998172680 5:139881759-139881781 GGGCTATCTCTGAGAAAAGCTGG + Intronic
999132022 5:149291081-149291103 AAGGTATCCCTGAGGAAGTCAGG + Intronic
1001884150 5:175273702-175273724 GTGGGATCCTTGAGAAAAGGGGG - Intergenic
1002077806 5:176719573-176719595 GTGGAATCCCTGGGTCAGGCAGG + Intergenic
1002596747 5:180328668-180328690 GTGCTGTCCCTGAGCAGGGCAGG - Intronic
1002663640 5:180807347-180807369 GTGTTGTCCCTGGGAAAAGCAGG + Intronic
1005607816 6:27492966-27492988 GGGGTTTCCATGGGAAAGGCAGG - Intergenic
1005647446 6:27854781-27854803 GAAGCATCCCTTAGAAAGGCAGG - Intronic
1006898249 6:37484277-37484299 GTGGGCTCCCTGCTAAAGGCTGG - Intronic
1008396015 6:51007832-51007854 GTGGTTTCCCTGTGAGAGGTAGG - Intergenic
1011083413 6:83512736-83512758 GAAATTTCCCTGAGAAAGGCAGG + Intronic
1015746724 6:136517828-136517850 CTGATATCCCTGATAAGGGCTGG + Intronic
1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG + Intronic
1019722611 7:2582390-2582412 GTCCTGTCCCTGAGTAAGGCTGG - Intronic
1022234492 7:28447779-28447801 GAGGTATACCTGAGACGGGCTGG - Intronic
1022257867 7:28677398-28677420 GTGGTGTGCCTGAGAATGTCTGG - Intronic
1022726265 7:32984744-32984766 GTGGTATCACTGTGACAGGAAGG + Intronic
1024744816 7:52393967-52393989 GGGGTATCTCTGTGAAAGGGAGG - Intergenic
1025047330 7:55702917-55702939 GTGGTATCACTGTGACAGGAAGG - Intergenic
1041420210 8:57659661-57659683 GGTGTATGCCTGACAAAGGCTGG - Intergenic
1044738076 8:95299514-95299536 GAGGTATCCCTGAGAGTGGAAGG + Intergenic
1046195942 8:110862509-110862531 GTGGTTGCCCTATGAAAGGCAGG - Intergenic
1047220855 8:122917106-122917128 CTGGGAGCCCTGAGAAACGCAGG - Intronic
1047224114 8:122942457-122942479 GTGGCATCCCTGTCAAAGCCCGG + Intronic
1047232033 8:123005707-123005729 GTGCTATTTCTGAGAAAGGCTGG - Intergenic
1047575611 8:126150838-126150860 TTGGCATTCCTGAGAAAGGAGGG + Intergenic
1048350702 8:133613635-133613657 GTGGAATCCATGAGAGAGTCAGG + Intergenic
1048569893 8:135643426-135643448 CTGGTATCCCTGAGTGAGGTTGG - Intronic
1049127448 8:140804813-140804835 GTGGCCTCCCGGGGAAAGGCAGG - Intronic
1049421967 8:142521004-142521026 GTGGGATCCCTGGGAAACTCAGG + Intronic
1054746566 9:68859653-68859675 GTGGTATCCTGGAGGAAGGAAGG + Intronic
1056105527 9:83342998-83343020 GTGGGGTCCCGGTGAAAGGCTGG - Intronic
1056578930 9:87876416-87876438 GTGCTTTCCCTGACAAGGGCAGG + Intergenic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1057515105 9:95714173-95714195 GGGGAACCCCTGAGAAAGGAAGG + Intergenic
1058712880 9:107696268-107696290 GTGGTGTGCCTGAGAAAGGCAGG + Intergenic
1058917971 9:109585968-109585990 CTGATATCCCTGGGAAAGGCTGG - Intergenic
1058990682 9:110253257-110253279 ATGGTGTTCCTGAGAAAGGTAGG + Intronic
1059758145 9:117312923-117312945 GAGATATCACTGAGACAGGCAGG - Intronic
1061884965 9:133586791-133586813 GTGGCAGTCCTGAGAAAGGCAGG - Intergenic
1190506261 X:51129220-51129242 CTGGTATCCCTGAAAAAGATGGG - Intergenic
1193703568 X:84792514-84792536 GTGGTGTCCCTGAAAAAGATGGG + Intergenic
1194026836 X:88763446-88763468 TTGGTATCTCTGAGAAAGACTGG - Intergenic
1197455367 X:126671836-126671858 GTGGGGTACCTGAAAAAGGCAGG + Intergenic
1199199354 X:145068819-145068841 CTGGGATTCCTCAGAAAGGCTGG + Intergenic