ID: 953518736

View in Genome Browser
Species Human (GRCh38)
Location 3:43621798-43621820
Sequence CGGCGACCAGGCGGAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953518722_953518736 19 Left 953518722 3:43621756-43621778 CCCAGGGGTGCTGGCACCGGGAG 0: 1
1: 0
2: 0
3: 21
4: 198
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518723_953518736 18 Left 953518723 3:43621757-43621779 CCAGGGGTGCTGGCACCGGGAGG 0: 1
1: 0
2: 2
3: 22
4: 249
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518732_953518736 -8 Left 953518732 3:43621783-43621805 CCCGGGAACGCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 13
4: 101
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518717_953518736 25 Left 953518717 3:43621750-43621772 CCCATCCCCAGGGGTGCTGGCAC 0: 1
1: 0
2: 1
3: 23
4: 207
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518718_953518736 24 Left 953518718 3:43621751-43621773 CCATCCCCAGGGGTGCTGGCACC 0: 1
1: 0
2: 5
3: 39
4: 343
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518721_953518736 20 Left 953518721 3:43621755-43621777 CCCCAGGGGTGCTGGCACCGGGA 0: 1
1: 0
2: 1
3: 23
4: 187
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518728_953518736 3 Left 953518728 3:43621772-43621794 CCGGGAGGCGGCCCGGGAACGCA 0: 1
1: 0
2: 1
3: 12
4: 113
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116
953518733_953518736 -9 Left 953518733 3:43621784-43621806 CCGGGAACGCAGGGCGGCGACCA 0: 1
1: 0
2: 0
3: 6
4: 66
Right 953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG 0: 1
1: 0
2: 2
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953518736 Original CRISPR CGGCGACCAGGCGGAGCTCC TGG Intronic
900102135 1:966448-966470 CCGCGGGCAGGCGGGGCTCCGGG - Intergenic
900476119 1:2877140-2877162 CTGGGAACAGGAGGAGCTCCGGG + Intergenic
900608068 1:3532581-3532603 CTGGGAACAGGCTGAGCTCCAGG - Intronic
901136251 1:6998407-6998429 CGGAGAGCACGCAGAGCTCCAGG - Intronic
903724710 1:25431531-25431553 CGGCGGCCAGTCAGAGGTCCCGG - Intronic
904852393 1:33468749-33468771 AGGTGGCCAGGAGGAGCTCCAGG - Intergenic
906551229 1:46668106-46668128 CGGGGCCGAGGCCGAGCTCCAGG - Exonic
907364072 1:53945637-53945659 CGGCGAGCAGGCGGAGCTGCGGG - Exonic
916053075 1:161049438-161049460 GGGCTACCTGGAGGAGCTCCTGG - Exonic
922116285 1:222617867-222617889 CAGGGACCAGGCGGAGCGCCGGG - Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1065140365 10:22714053-22714075 GGGCGAGCAGCCGGAGGTCCAGG + Intronic
1074780224 10:116797107-116797129 CAGCCACCAGGGGGAGCTACAGG + Intergenic
1076707106 10:132308020-132308042 CGGGGGCGGGGCGGAGCTCCTGG + Intronic
1077283650 11:1756543-1756565 CAGTGACCAGGCGCAGCTCAGGG + Intronic
1078023537 11:7673803-7673825 CGTCGGCCAGGCGGAGCTGCGGG - Exonic
1078081524 11:8207678-8207700 CGGCGGCCAGGTGCAGGTCCTGG - Intergenic
1082807645 11:57460766-57460788 CGGGGACCCCGCGGGGCTCCGGG - Exonic
1083677161 11:64332533-64332555 GGGGTGCCAGGCGGAGCTCCGGG + Intergenic
1083805049 11:65068342-65068364 GGGCGTCCAGGCCCAGCTCCTGG - Intronic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1088687570 11:112297966-112297988 CAGCGACCAGGTGGTGCTGCTGG + Intergenic
1091297165 11:134482134-134482156 CTGCCACCAGACGGAGTTCCTGG - Intergenic
1091791686 12:3275614-3275636 CGGCCACTAGGTGGCGCTCCAGG - Intronic
1095958382 12:47819347-47819369 CGGCGAGGGGGCGGTGCTCCGGG - Intronic
1097014314 12:55974368-55974390 CGGCGGCCAGGCCGAGGGCCGGG + Intronic
1101754123 12:107607684-107607706 TGGCCACCAGGGGGAGCTGCTGG - Intronic
1104966902 12:132512425-132512447 CAGCGCCCTGGCTGAGCTCCAGG + Intronic
1105014157 12:132776062-132776084 CTGCGGCCAGGCAGTGCTCCCGG - Intronic
1105031502 12:132887448-132887470 CGGCGTCCAGGCCGGGCTGCGGG - Intronic
1112378202 13:98863429-98863451 TGGCGATCAGACGGACCTCCCGG + Exonic
1113428010 13:110225728-110225750 GGGTGAGCACGCGGAGCTCCGGG + Intronic
1114483289 14:23048207-23048229 CGCCGACGTGGCGCAGCTCCTGG - Exonic
1117029455 14:51652721-51652743 CGGCGCGCTGGCGGAGCCCCAGG + Intronic
1118391366 14:65298582-65298604 GTGCAACCAGGCCGAGCTCCAGG - Intergenic
1121637879 14:95466047-95466069 GGACAACCAGGCGGTGCTCCTGG - Exonic
1124121665 15:26893755-26893777 CGGCGACCAGGCGGTGGGCACGG + Intronic
1124484664 15:30103819-30103841 CGACCACCAGGCGGGGCCCCCGG - Intergenic
1124518917 15:30393419-30393441 CGACCACCAGGCGGGGCCCCCGG + Exonic
1124539739 15:30572827-30572849 CGACCACCAGGCGGGGCCCCCGG - Intergenic
1124758913 15:32434755-32434777 CGACCACCAGGCGGGGCCCCCGG + Intergenic
1128261914 15:66238503-66238525 CTGCCTCCAGGCGGTGCTCCTGG - Intronic
1128978379 15:72169258-72169280 GGGAGACCAGGCGCACCTCCAGG - Intronic
1131381815 15:91970521-91970543 CTGTGACCAGGAGGTGCTCCTGG + Intronic
1132157352 15:99504925-99504947 AGGCCTCCAGGAGGAGCTCCAGG - Intergenic
1132809725 16:1791754-1791776 CAGCGGCCTGGCCGAGCTCCGGG - Exonic
1132850058 16:2020844-2020866 CGCCGACCAGGGGAAGCGCCGGG + Intergenic
1136412746 16:30086478-30086500 AGGGGACCAGGCGGGGCTGCGGG - Intronic
1136536458 16:30902523-30902545 CGGCGCTCAGGCCGAGCCCCCGG - Exonic
1140408240 16:74725132-74725154 CGGTGACCGGGAGGAGCTCTGGG + Intronic
1142717281 17:1754207-1754229 CGCCGACCTCGCTGAGCTCCAGG - Exonic
1143554218 17:7650834-7650856 TGGCGAGGAGGCGGAGCTTCTGG + Intronic
1143908274 17:10227032-10227054 CGGCCACTAGGGGGAGCTCAAGG - Intergenic
1144682689 17:17205986-17206008 AGGCGAACAGGCAGAGATCCAGG + Exonic
1145765686 17:27456885-27456907 CGGGGACCAGGCTGGGCTCGAGG + Intronic
1149891247 17:60392087-60392109 CGGCGACCGGGAGGAGCCGCCGG - Exonic
1150699436 17:67434518-67434540 CCGCGCCCAGCCTGAGCTCCGGG - Intronic
1152244845 17:79179933-79179955 CGGCGCCCAAGTGGGGCTCCTGG + Intronic
1152394509 17:80024095-80024117 CCGCGACAAAGCGCAGCTCCGGG + Intronic
1152523665 17:80875256-80875278 CAGAGACCAGGAGGAGCCCCTGG - Intronic
1152584119 17:81181533-81181555 GGGCAACCAGGCGGGGCTCACGG - Intergenic
1152719734 17:81917692-81917714 CGACGACCCGGAGGAGCTGCGGG - Exonic
1152846233 17:82601376-82601398 CGGTGACCAGCCGGAGCAGCCGG + Exonic
1160858428 19:1227600-1227622 CGGGCACCTGGCGGGGCTCCTGG - Exonic
1160908992 19:1466217-1466239 CGGCTGCCAGGCCGAGCCCCCGG + Exonic
1161355995 19:3819955-3819977 AGGCGACCACCCGGGGCTCCAGG + Intronic
1163371252 19:16902560-16902582 CTGGGACCAGGAGGAGCTTCCGG - Intronic
1163651356 19:18520176-18520198 CAGAGAGAAGGCGGAGCTCCTGG + Intronic
1163844027 19:19628500-19628522 CGCTGCCCGGGCGGAGCTCCAGG + Exonic
1166091550 19:40512658-40512680 CGGCTGCCTGGCGGAGCTGCAGG + Exonic
1168292263 19:55362427-55362449 CCGAGACCAGGCGCAGCTTCAGG + Exonic
1168293821 19:55369511-55369533 CGCCCACCCGGCGGGGCTCCTGG - Intronic
1168300260 19:55401025-55401047 AGGCCACCAGGAGCAGCTCCAGG + Exonic
1168685572 19:58347359-58347381 CAGCGACCCTGTGGAGCTCCTGG - Exonic
1168694498 19:58396859-58396881 CGGCGTCCAGGCGGGGGCCCAGG - Exonic
926980188 2:18560287-18560309 CCGCGGCCTGGCGGAGCTCGCGG + Exonic
931021185 2:58046793-58046815 CTGCGACGAGGCGGAGCCCCCGG - Intronic
933728036 2:85437561-85437583 AGGGGGCCAGGCGGAGCTGCGGG + Intergenic
935653227 2:105399362-105399384 CTGGGACCAGGCAGAGATCCCGG - Intronic
948140821 2:235670632-235670654 CGGCGCCCAGGCCAGGCTCCCGG - Intronic
948845404 2:240680601-240680623 GGGGGACCAGGCGGGGCTTCAGG - Intronic
948848457 2:240694278-240694300 GGGGGACCAGGCGGGGCTTCAGG + Intronic
1176020376 20:62959604-62959626 GGGCCGCCTGGCGGAGCTCCTGG - Intronic
1182299240 22:29328716-29328738 GAGGGACCAGGCGGGGCTCCAGG - Exonic
1184677655 22:46052542-46052564 CGGCGAGCAAGAGCAGCTCCTGG - Intronic
950141984 3:10621876-10621898 CGCTGACCAGGCTGTGCTCCCGG + Intronic
953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG + Intronic
954443309 3:50533537-50533559 CGGAGACCAGGCGACCCTCCTGG + Intergenic
954763972 3:52897552-52897574 CGGCGGCCGGGCGGAGGTACCGG - Exonic
963888875 3:150611725-150611747 GGGCGGCCAGGCCGGGCTCCTGG - Intronic
969252709 4:5980179-5980201 CCGCCTCCAGGAGGAGCTCCAGG - Exonic
970794207 4:19892307-19892329 CAGCGACCAGAGGGAGCTCTGGG - Intergenic
972543129 4:40056646-40056668 CCGCGCCGAGGCGGAGCTCGGGG + Intergenic
978954759 4:114599414-114599436 GGGGGACCAGGAGGAGCTTCGGG + Intronic
981167696 4:141581274-141581296 TGGCCACCCAGCGGAGCTCCTGG - Intergenic
982605793 4:157514981-157515003 CTGCCACCAGGCGGAGCTCCTGG + Intergenic
998540466 5:142976886-142976908 TGGAGACCAGGAGAAGCTCCTGG + Intronic
1001638373 5:173228778-173228800 CCCCTACCAGGCTGAGCTCCTGG - Intergenic
1002660332 5:180787236-180787258 CGGCCACCAGGCTGGTCTCCAGG + Intergenic
1005826263 6:29633111-29633133 CGGGGACCAGGGAGAGCTCCCGG + Exonic
1012476389 6:99618843-99618865 CGGCGGCCAGGCGGAGCCGGAGG + Intergenic
1015626295 6:135182877-135182899 GGGCGACTTGGGGGAGCTCCGGG + Intronic
1016590193 6:145735435-145735457 CGGCGCCCGGCCGGAGCTGCTGG - Exonic
1018856845 6:167681016-167681038 CAGTGAGCAGGCGGAGTTCCAGG - Intergenic
1020371100 7:7432663-7432685 CGGGGACCAGTGGGTGCTCCAGG - Exonic
1030231618 7:107213575-107213597 CTGCAATCAGGCGGAGCTGCTGG - Intronic
1032194248 7:129780408-129780430 GGGCAAGCAGGCGGGGCTCCCGG - Intergenic
1033595315 7:142854882-142854904 CGGCGCACAGGCGGGGCCCCGGG + Intergenic
1033672942 7:143510955-143510977 CGGCGGCCAGGCCAAGCTCCAGG - Intergenic
1035581001 8:738836-738858 CGGCGAGAAGGCGGAGCCCCCGG + Intergenic
1036390330 8:8319026-8319048 CAGCCACCAGGCGGAGCCCGAGG - Exonic
1039858223 8:41434740-41434762 CGGTGACCAGGCTGGGCTCAGGG + Intergenic
1039896360 8:41719418-41719440 CGGTGACCAGGCCGAGGTCAGGG - Intronic
1042137408 8:65645135-65645157 CGGCCGCCAGGCGGCGGTCCTGG + Intronic
1042956916 8:74260679-74260701 AGGCTGGCAGGCGGAGCTCCTGG + Intronic
1047423738 8:124727750-124727772 CGGCCACCTGCGGGAGCTCCCGG - Intronic
1047448333 8:124939368-124939390 TTGGGACCAGGAGGAGCTCCTGG - Intergenic
1051162105 9:14220524-14220546 GGGCTCCCAGGCGGGGCTCCTGG - Intronic
1060147971 9:121268317-121268339 CCGCGGCCGGGCCGAGCTCCAGG - Intronic
1060517545 9:124275480-124275502 CCTCTGCCAGGCGGAGCTCCTGG + Intronic
1061201943 9:129143116-129143138 CTGCCAGCAGGGGGAGCTCCAGG - Intronic
1192174546 X:68877758-68877780 GGGCCTCCAGGCTGAGCTCCCGG + Intergenic
1194513386 X:94821995-94822017 GGGAGAGAAGGCGGAGCTCCAGG + Intergenic
1198423986 X:136497033-136497055 CGGGGACCCCGCGGAGCTCAAGG + Intergenic
1202048358 Y:20756357-20756379 CGGCGCCCAGGCCGAGCACAAGG - Intronic