ID: 953520705

View in Genome Browser
Species Human (GRCh38)
Location 3:43639937-43639959
Sequence GACACTCCAGTGAGTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953520705_953520707 10 Left 953520705 3:43639937-43639959 CCAGCTGAACTCACTGGAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 953520707 3:43639970-43639992 GCAAGCCTAGTCCTGAGAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 86
953520705_953520709 12 Left 953520705 3:43639937-43639959 CCAGCTGAACTCACTGGAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 953520709 3:43639972-43639994 AAGCCTAGTCCTGAGAGTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 92
953520705_953520708 11 Left 953520705 3:43639937-43639959 CCAGCTGAACTCACTGGAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 953520708 3:43639971-43639993 CAAGCCTAGTCCTGAGAGTCGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953520705 Original CRISPR GACACTCCAGTGAGTTCAGC TGG (reversed) Intronic
902573554 1:17362286-17362308 GACACTGCAGTGAGCTGAGATGG + Intronic
903355778 1:22746547-22746569 GTCACTGCAGTGTGTTCTGCAGG + Intronic
905688980 1:39928841-39928863 GTCACCTCAGAGAGTTCAGCAGG - Intergenic
906129591 1:43448182-43448204 GAGGCTCCTGGGAGTTCAGCTGG + Exonic
921363697 1:214354008-214354030 TAAACTCCAGTGGGTACAGCAGG - Exonic
924843692 1:247743318-247743340 GACACTCCAGTGGAGGCAGCAGG - Intergenic
1063650208 10:7928249-7928271 GACACGGCAGTGAGTTAAACAGG - Intronic
1066332036 10:34434193-34434215 GAGACTAGAGTGAGTTCAGCAGG + Intronic
1074744952 10:116523309-116523331 GACACTACCTGGAGTTCAGCTGG - Intergenic
1078427579 11:11264542-11264564 CATAATCCAGTGAGCTCAGCAGG + Intergenic
1078519728 11:12053291-12053313 GAGACTTCAGTGACTTCAACAGG - Intergenic
1078620231 11:12900473-12900495 GACACTCCACAGACTTCATCAGG - Intronic
1085544447 11:77303943-77303965 CACGCTCCAGAGAATTCAGCTGG - Intergenic
1086541080 11:87913870-87913892 GACTCTACAGAGAGTTCCGCCGG + Intergenic
1086860552 11:91920408-91920430 GACACTTTCGTGTGTTCAGCAGG - Intergenic
1090635383 11:128687621-128687643 GACACTCGAGGGAGCTCAGCTGG - Intronic
1098252991 12:68588688-68588710 GAGGCTCCAGTGAGTTGAGATGG - Intergenic
1102656743 12:114488387-114488409 GTCTCAGCAGTGAGTTCAGCAGG + Intergenic
1103270703 12:119670921-119670943 GACTCTTCAGGGAGTTAAGCAGG - Intronic
1103756465 12:123211415-123211437 GAGACTCCAGTGAGCTGGGCTGG - Intronic
1105466056 13:20641109-20641131 TACACTCCAGTGTGGGCAGCAGG + Intronic
1107070093 13:36259455-36259477 GACACTCCACAGAGTGAAGCAGG + Intronic
1109157339 13:58927174-58927196 GACACTCCAGTGAGAGAAGAGGG - Intergenic
1112523911 13:100124656-100124678 TACCCTCCAGTTTGTTCAGCTGG - Intronic
1113715860 13:112506934-112506956 TACAGTCCAGTGACTTCAGTGGG - Intronic
1113771999 13:112916416-112916438 GAAACACCAGTGAGTCAAGCAGG - Intronic
1119459001 14:74782249-74782271 GACATGCCAGTGAGATCAGGTGG + Exonic
1120007453 14:79375437-79375459 GACACTCCTGAGACTTCAGCAGG - Intronic
1125362544 15:38879362-38879384 GAGACTCAAGTGAGTGTAGCTGG - Intergenic
1127658397 15:61077070-61077092 AACACTGCAGTGGGATCAGCAGG + Intronic
1128107241 15:65054088-65054110 GTCACTCCAGTGAGTTACCCAGG - Exonic
1131195683 15:90352748-90352770 GAAGCTCCAGTGCGTTCACCGGG - Intronic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1131603153 15:93870725-93870747 GTCACTCCATGGAATTCAGCGGG + Intergenic
1131808496 15:96147969-96147991 GACATTCCAGAGAGTGAAGCAGG - Intergenic
1132025786 15:98403452-98403474 GAAATTCCAGTGAGACCAGCTGG - Intergenic
1132376613 15:101332342-101332364 GAGGCTGCAGTGAGATCAGCAGG - Intronic
1133741685 16:8656583-8656605 GAGACTCCAGTTACCTCAGCAGG + Intergenic
1138475678 16:57269436-57269458 GACACACCTGTGAGGTGAGCAGG - Intronic
1140565510 16:76036889-76036911 TACACTCCATAGAGTGCAGCAGG + Intergenic
1141967170 16:87453336-87453358 TACTCTCCAGTGACTTCAGAGGG - Intronic
1142167464 16:88600051-88600073 GAGACTCCAGTGAGTGGGGCTGG - Intronic
1142344417 16:89544949-89544971 GCCACAGCAGTGAGTGCAGCCGG - Intronic
1142470113 17:158455-158477 GAGACTCCTGTGAGGTGAGCAGG + Intronic
1143033307 17:3980235-3980257 CGCACTCCGGTGAATTCAGCTGG - Intergenic
1144745878 17:17614025-17614047 GACCCTCCAGGGAGAACAGCTGG + Intergenic
1147906706 17:43827931-43827953 GACAGTCCAGAGAGATCAGTGGG + Intronic
1148049871 17:44764571-44764593 GCCATGCCAGAGAGTTCAGCAGG + Intronic
1154073280 18:11174745-11174767 TTCACTCCAAAGAGTTCAGCAGG - Intergenic
1161775921 19:6262096-6262118 GACATTCCAGTGAGTGCTGCGGG - Intronic
1162301292 19:9846625-9846647 ATCAGTCCAGTGTGTTCAGCAGG + Intronic
1162938226 19:13992599-13992621 GGCACTTCAGGGAGGTCAGCTGG - Intronic
1164397030 19:27875073-27875095 GTGACTGCAGTGAGTTGAGCTGG - Intergenic
1164947917 19:32311763-32311785 GACACTCCAGTGAGATTCGTAGG - Intergenic
927753766 2:25692511-25692533 GACATTGCAGTGAGTTGAGATGG - Intergenic
931827514 2:66017052-66017074 GACACTTCAGTGAGTCAAGTTGG - Intergenic
934035062 2:88082376-88082398 GACACAGCAGTGTGTTGAGCTGG + Intronic
936902166 2:117493711-117493733 AAAAATCCAGTGGGTTCAGCTGG - Intergenic
937745689 2:125410878-125410900 CACTCTCCAGTCTGTTCAGCTGG - Intergenic
939310456 2:140468661-140468683 GCCACACCAGTGTGTTCAGAAGG + Intronic
940005821 2:149008640-149008662 AACTCACCAGTGATTTCAGCAGG + Intronic
944527428 2:200634278-200634300 GACACAGCAGTGAGTTCAGTGGG - Intronic
948139987 2:235665453-235665475 GGGTCCCCAGTGAGTTCAGCTGG + Intronic
948185717 2:236019832-236019854 GACACTGCAGTGAGTCCTTCAGG - Intronic
1174173108 20:48629114-48629136 GAGCCTCCAGTGAGGTCAGCAGG + Intronic
1175228703 20:57460317-57460339 GACACCCCAGTGAGGGCAGGAGG - Intergenic
1175689912 20:61057721-61057743 GACACTCCAGGAAGCTCAGCGGG + Intergenic
1178246358 21:30956828-30956850 GGCAGCCCAGTGAGTTCACCAGG + Intergenic
1179060097 21:37971901-37971923 GACCCTCCAGAGACTGCAGCAGG - Intronic
1182195785 22:28515847-28515869 AAAATTTCAGTGAGTTCAGCCGG + Intronic
1184276761 22:43413068-43413090 GACATCCCAGAGAGGTCAGCTGG - Intronic
949530819 3:4953430-4953452 GACACCACAGTGAAATCAGCTGG - Intergenic
950959915 3:17094617-17094639 GCCACTGCAGGGAGCTCAGCTGG + Intergenic
951723616 3:25729741-25729763 GTCACTGAAGTGAGTTAAGCAGG - Intronic
953520705 3:43639937-43639959 GACACTCCAGTGAGTTCAGCTGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
958784669 3:98584753-98584775 GACACCCCACTGAGCTCACCAGG + Intronic
966509321 3:180743933-180743955 GACAGAGCAGTGAGATCAGCCGG + Intronic
969179090 4:5423767-5423789 GACACTGCAGTGAGTCCAGAGGG + Intronic
969288015 4:6219895-6219917 GATTCTCCTGTGAGTTTAGCAGG + Intergenic
969781260 4:9406079-9406101 GATACACTGGTGAGTTCAGCTGG - Intergenic
969904850 4:10384315-10384337 AACACTGCAGTGAATGCAGCAGG - Intergenic
970072677 4:12179308-12179330 GAAACTCAAGTGACTTAAGCTGG + Intergenic
972723863 4:41728486-41728508 GATACTCCACTGTGATCAGCCGG + Intergenic
980729194 4:136805016-136805038 GACACAGGAGTGAGTTCTGCAGG - Intergenic
981546904 4:145902967-145902989 GACACTGCAGTGAGTCTCGCAGG + Exonic
981675264 4:147335978-147336000 TACAATCTAGTGAGTTCAACAGG + Intergenic
982205002 4:152991001-152991023 TACACTCCAGTGAGATAGGCAGG - Intergenic
983583678 4:169333941-169333963 GAAACTCCAGAGATGTCAGCAGG - Intergenic
983605266 4:169575670-169575692 GACACTCCAGGCAGTTTCGCAGG + Intronic
992697240 5:79302101-79302123 AACATTGCAGTGATTTCAGCAGG + Intronic
993574653 5:89586610-89586632 GCCACCCCAGTGGGTTCAGGAGG - Intergenic
996703066 5:126469192-126469214 GACACTGCAATGATTTCATCAGG - Intronic
1013515157 6:110878101-110878123 AACACTCCAGTGAAATCATCTGG - Intronic
1018305034 6:162445902-162445924 GACACTCCAGTGAGGGCAGGTGG + Intronic
1023245737 7:38201751-38201773 GACGCTCCAGTGAGCTGAGATGG - Intronic
1023681663 7:42693815-42693837 GTCACTCCAGGGAGTTGGGCTGG - Intergenic
1023875077 7:44282460-44282482 GACACTGCAGAGGGTTCAGCAGG - Intronic
1027419319 7:78004419-78004441 GCCAATGCAGGGAGTTCAGCTGG + Intergenic
1034083633 7:148303347-148303369 GTCACTTCAGTATGTTCAGCAGG - Intronic
1038513668 8:28164516-28164538 GGGACTCTAGTGAGTTCAGAAGG + Intronic
1039887918 8:41665706-41665728 GACAGTCAAGTGAGCCCAGCAGG + Intronic
1041499704 8:58527186-58527208 GTCACTCCAGTGGCTCCAGCCGG - Intergenic
1042633205 8:70843984-70844006 GACATTCCACTGGGTCCAGCTGG - Intergenic
1044883242 8:96746069-96746091 AACACTGCAGTGAGTTAAGGAGG - Intronic
1047294603 8:123559785-123559807 AACACTGCAGTGATTTCAACAGG - Intergenic
1057070144 9:92090545-92090567 GACACTGCAGTGAGCTGAGACGG + Intronic
1058712927 9:107696822-107696844 GACACTCGACTGGGTTCTGCAGG + Intergenic
1060438094 9:123613136-123613158 GATACTCCACTGAGTTCAGGAGG + Intronic
1060925767 9:127454209-127454231 GACTTTCCAGTGAGTTCCACGGG - Intronic
1062105524 9:134752870-134752892 GTCACTTGAGGGAGTTCAGCGGG + Intronic
1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG + Intergenic
1187396547 X:18924358-18924380 GTAACTCCAGGGATTTCAGCAGG - Intronic
1188869584 X:35358217-35358239 GTCATTCCAGCCAGTTCAGCTGG + Intergenic
1192941384 X:75915686-75915708 GACATTCCAGTGTGTTCAAAGGG + Intergenic
1194468066 X:94256983-94257005 GTCATTTCAGTGATTTCAGCTGG - Intergenic
1201753580 Y:17461602-17461624 GAGACTCCAGGCAGTTGAGCAGG - Intergenic
1201847973 Y:18444381-18444403 GAGACTCCAGGCAGTTGAGCAGG + Intergenic