ID: 953520937

View in Genome Browser
Species Human (GRCh38)
Location 3:43642675-43642697
Sequence AATTACCTATAGGAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953520937_953520944 7 Left 953520937 3:43642675-43642697 CCCCCCACCTCCTATAGGTAATT 0: 1
1: 0
2: 1
3: 16
4: 193
Right 953520944 3:43642705-43642727 TTGCTTCTTTTTGCAAATATAGG 0: 2
1: 0
2: 3
3: 53
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953520937 Original CRISPR AATTACCTATAGGAGGTGGG GGG (reversed) Intronic
904081998 1:27877999-27878021 AATTAGCTAGGGGTGGTGGGGGG + Intronic
904501483 1:30915292-30915314 AGCTGCCTCTAGGAGGTGGGTGG + Intergenic
910821810 1:91358833-91358855 ATGTACCTTTAGGAGGTGGCTGG - Intronic
911982596 1:104585129-104585151 AGTGACCTATAGGAGGTGACTGG - Intergenic
912863974 1:113240343-113240365 AATTACCTATAGAAAAGGGGTGG - Intergenic
912893250 1:113557781-113557803 ACGTACCTGTAGGAGGTGGCTGG - Intronic
914414661 1:147468828-147468850 AAGTGCCTGTAGGAGGTGGCTGG + Intergenic
914699886 1:150122319-150122341 AAAGACTTAAAGGAGGTGGGGGG + Intronic
914943697 1:152045240-152045262 AATGCCCTCTAGAAGGTGGGTGG - Intronic
915287378 1:154861613-154861635 GATTCCCTGTAGGAGGTTGGGGG - Intronic
916337844 1:163693076-163693098 AATTCCCTGTAGGAGGCAGGAGG + Intergenic
917585928 1:176426242-176426264 AAACACCTGTAGGAGGTGGCTGG + Intergenic
921880897 1:220253225-220253247 ATGTACCTGTAGGAGGTGGCTGG - Intronic
921991310 1:221370673-221370695 AATTATCTTTAGGAGATGTGGGG + Intergenic
922089485 1:222382159-222382181 ATATTCCTGTAGGAGGTGGGGGG - Intergenic
922626040 1:227044515-227044537 AATTGCCTGTAGGAAGTAGGAGG - Intronic
923292199 1:232557081-232557103 AAATACTGATAGGAGGTGAGAGG + Intronic
1063924798 10:10967149-10967171 AATGACCTACAGAACGTGGGAGG + Intergenic
1064024838 10:11839674-11839696 AATTAGCTAGATGTGGTGGGGGG + Intronic
1064641754 10:17422333-17422355 AATTACTTGTGGGAGGGGGGAGG - Intronic
1068289298 10:54981765-54981787 AATTAATTAAAGGAGGTGGGGGG - Intronic
1068712808 10:60152825-60152847 AATTACCTTGAGGAGGTAAGAGG - Intronic
1068811089 10:61256925-61256947 ACATGCCTATAGGAGGTGGCTGG + Intergenic
1070025863 10:72631416-72631438 TTTTACCACTAGGAGGTGGGAGG + Intergenic
1070054679 10:72923656-72923678 ACACACCTATAGGAGGTGGCTGG + Intronic
1072199491 10:93145436-93145458 AATTACCCAGAGGTGGTGGCGGG + Intergenic
1074570276 10:114618025-114618047 ATTTGCCTATAGGGGTTGGGAGG - Intronic
1076387939 10:130072001-130072023 AATCAATTCTAGGAGGTGGGAGG - Intergenic
1080260120 11:30340462-30340484 AATCACCTTTTGGAGGTGGAAGG - Intergenic
1080513708 11:33000869-33000891 AGGCACCTATAGGAGGTGGCTGG + Intergenic
1080858115 11:36129780-36129802 AAAGACCCAGAGGAGGTGGGTGG - Intronic
1083076400 11:60043237-60043259 AATTTCATGGAGGAGGTGGGAGG - Intronic
1084468433 11:69340994-69341016 AACTTCCTCCAGGAGGTGGGAGG - Intronic
1085553985 11:77402811-77402833 AATTACCTTTTAGAGGTGGGAGG - Intronic
1085697960 11:78721785-78721807 CATTCCCTAAAGGAGTTGGGAGG + Intronic
1086610418 11:88748665-88748687 ATTCACCTGTAGGAGGTGGCTGG - Intronic
1086743656 11:90399458-90399480 TATGTCCTTTAGGAGGTGGGTGG + Intergenic
1087770234 11:102201396-102201418 TGTTACCTATTGGAGGTAGGAGG + Intronic
1089512023 11:119005315-119005337 AATTACCCAGACGAGGTGGTGGG + Intronic
1090206384 11:124886766-124886788 ATGTACCCATAGGTGGTGGGGGG + Exonic
1092698896 12:11204942-11204964 GGTTACCTACAGGAAGTGGGTGG + Intergenic
1093072316 12:14719288-14719310 AATTACCTACATCAGGTGAGTGG - Intergenic
1094396956 12:30017256-30017278 AAATACCTTGAAGAGGTGGGTGG - Intergenic
1095219129 12:39587624-39587646 GGTTAGCTACAGGAGGTGGGAGG + Intronic
1095478148 12:42607212-42607234 AGTTGACTATAGGAAGTGGGTGG + Intergenic
1101334409 12:103783666-103783688 AATTAATTATATGAGGTGTGGGG - Intronic
1102616050 12:114155157-114155179 AATTACCTTTTGGAGAAGGGTGG - Intergenic
1104393786 12:128414418-128414440 AATTACCTATAGGAGTAAAGTGG - Intronic
1106958697 13:34973215-34973237 ACATACCTGTAGGAGGTGGCTGG + Intronic
1107542290 13:41402740-41402762 CACTGCCGATAGGAGGTGGGTGG - Intergenic
1108318172 13:49258728-49258750 ACTTACCTATAGTAGGAGGTGGG + Intronic
1108877402 13:55063460-55063482 AATTACCTATAGGCCGGGCGCGG + Intergenic
1109326349 13:60871959-60871981 AAAGACCTATAGGAGGTGGCAGG - Intergenic
1109523464 13:63544104-63544126 AATTACAAATAGAAGGTGAGAGG - Intergenic
1112755341 13:102626122-102626144 AGTTAACTGTAGGAGGTGGGAGG - Intronic
1115633938 14:35272643-35272665 AATTACATATCTGAGATGGGAGG + Intronic
1116015801 14:39405367-39405389 GATTAGCTATAGGGGGTGAGGGG + Intronic
1116123910 14:40756860-40756882 ACTTGCCTGTAGGAGGTGGCTGG + Intergenic
1116786636 14:49295364-49295386 AATTGCCTCTTGGAGGAGGGTGG - Intergenic
1118333143 14:64829857-64829879 GGTTACCTATAGGGGGTGTGGGG - Intronic
1119331527 14:73798170-73798192 AATTACCTGGAGGAGGCAGGTGG + Intergenic
1125695699 15:41635516-41635538 AATTTTTTATAGGAGGGGGGGGG - Intronic
1126530503 15:49704757-49704779 TATTACCTCTGGGTGGTGGGGGG - Intergenic
1127330972 15:57939953-57939975 ACATACCTATAGGAGGTGGCTGG + Intergenic
1127890380 15:63245471-63245493 AATTACCTGGTGGTGGTGGGGGG - Intronic
1130809361 15:87360183-87360205 AATTTGCTGTAAGAGGTGGGAGG - Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1133539268 16:6733163-6733185 AATGACCTATGGGAGATGAGGGG - Intronic
1134286680 16:12868003-12868025 CTTTCCCTATGGGAGGTGGGAGG - Intergenic
1137551751 16:49442184-49442206 AGTTACCTCTAGGAGGTGAAAGG - Intergenic
1138011116 16:53380999-53381021 AATTACCTATAGGAGCAGATTGG - Intergenic
1138945750 16:61847585-61847607 AATTAATTATGGGAGGTGGGTGG + Intronic
1140754688 16:78056701-78056723 AATGAGCTGCAGGAGGTGGGAGG - Intronic
1143164816 17:4892496-4892518 TATTACCTAGAGGCGTTGGGCGG - Exonic
1143166257 17:4898693-4898715 AATTTCCTACTGGAGATGGGTGG + Exonic
1144351441 17:14401020-14401042 AATTACCTAGATGTGGTGGCGGG - Intergenic
1144718949 17:17454460-17454482 AAGTACCTGGAGTAGGTGGGTGG + Intergenic
1144895873 17:18531947-18531969 AAGTGCCTGTAGGAGGTGGCTGG - Intergenic
1145136344 17:20412285-20412307 AAGTGCCTGTAGGAGGTGGCTGG + Intergenic
1147032737 17:37653568-37653590 GGTTACCTACAGGAAGTGGGTGG + Intergenic
1148813920 17:50313148-50313170 AATAACGTATATGATGTGGGTGG + Intergenic
1149374749 17:56032817-56032839 AAATACCTTGAAGAGGTGGGAGG + Intergenic
1151777802 17:76219512-76219534 GATTATCTATAGGAGGAGGGAGG + Intronic
1153093513 18:1374678-1374700 AATTAGATAAAGGAGGTGGTTGG + Intergenic
1155391394 18:25340979-25341001 AATGACCTATATGATGTTGGAGG + Intronic
1161593132 19:5137662-5137684 GACCACCGATAGGAGGTGGGTGG + Exonic
1165773261 19:38390282-38390304 ATGTACCTGCAGGAGGTGGGGGG - Exonic
1166510060 19:43400840-43400862 ATTCACCTATAGGAGGAGGGAGG - Intergenic
1167370201 19:49076317-49076339 AGTTACTTAGAAGAGGTGGGAGG - Intergenic
1167661151 19:50796793-50796815 CATTCCCTAGAGGAGCTGGGTGG + Intergenic
929674671 2:43914577-43914599 AATTAGCTAGGGGTGGTGGGGGG + Intronic
930229385 2:48827705-48827727 ATTCACCTGTAGGAGGTGGCTGG - Intergenic
931287263 2:60843029-60843051 AAGTGCCTCTAGGTGGTGGGGGG - Intergenic
932293664 2:70606652-70606674 AATTACCTTAATGAAGTGGGTGG + Intergenic
932513379 2:72318633-72318655 AGTTACCTACTAGAGGTGGGTGG - Intronic
932593028 2:73078534-73078556 AACTACATATGGGAAGTGGGTGG - Intronic
936225757 2:110649111-110649133 AACTCCCTATTGGAGGTTGGGGG + Intronic
936967677 2:118143014-118143036 AATTACCTATTGGTGCGGGGAGG - Intergenic
937297938 2:120821026-120821048 CATTTCCTCGAGGAGGTGGGTGG - Intronic
939855381 2:147352730-147352752 AATTGTTTATAGGAGGTGGGAGG + Intergenic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
946094425 2:217260581-217260603 AAATACCAAGAGGATGTGGGTGG - Intergenic
946597164 2:221318701-221318723 AATTACCTATGCGAGGAGGCAGG + Intergenic
1171945487 20:31373260-31373282 AATTACATATTGGTGGGGGGTGG - Exonic
1173837646 20:46136324-46136346 AATTTCCCAGACGAGGTGGGAGG - Intergenic
1173894221 20:46538100-46538122 AATTGCCAAGAGGATGTGGGTGG - Intergenic
1178259431 21:31085244-31085266 AATTACCTTGTGGAGGCGGGGGG - Intergenic
1179001595 21:37465686-37465708 AATTAGCTATGGGTGGTGGCGGG + Intronic
950359046 3:12437472-12437494 AAATACCTAGTGGAGATGGGCGG + Intergenic
951234957 3:20223754-20223776 TATTACCAATAGGAGATTGGGGG - Intergenic
953520937 3:43642675-43642697 AATTACCTATAGGAGGTGGGGGG - Intronic
957398749 3:79680827-79680849 AAGAATCTCTAGGAGGTGGGGGG + Intronic
957714023 3:83901860-83901882 TAATTCCTATGGGAGGTGGGAGG - Intergenic
959339875 3:105115343-105115365 AATAAACTTTAGGAGGTGGAAGG - Intergenic
959452108 3:106517130-106517152 AATCACCTGTAGGAGGTGACTGG - Intergenic
959706352 3:109341875-109341897 AATAACATATTGGGGGTGGGTGG + Intergenic
960342863 3:116496939-116496961 AGGTACCTGTAGGAGGTGGCTGG - Intronic
962900393 3:139756519-139756541 AATTAGCTCCAGGAGGTGGGAGG - Intergenic
964250875 3:154715312-154715334 AATTTTGTATAAGAGGTGGGAGG + Intergenic
964255719 3:154772498-154772520 AAGCACCTGTAGGAGGTGGCTGG + Intergenic
966181791 3:177195692-177195714 ACTTAATTATATGAGGTGGGGGG + Intronic
967261853 3:187650093-187650115 GAATACCTTTAGGAGCTGGGAGG - Intergenic
967610610 3:191501529-191501551 AATTAGATTTAGGAGGTTGGAGG + Intergenic
968795735 4:2702988-2703010 AGTTACCTACAGGGAGTGGGTGG - Intronic
969781010 4:9404120-9404142 AATGACCTACAGGAGGGTGGGGG + Intergenic
970379580 4:15493374-15493396 AATTAGCTAGGTGAGGTGGGAGG - Intronic
970567448 4:17346548-17346570 AATTAGCTATGTCAGGTGGGAGG - Intergenic
976195198 4:82525439-82525461 AATTAACGATGGGAGGTGGGAGG + Intronic
976395511 4:84550747-84550769 ACGTACCTGTAGGAGGTGGCCGG - Intergenic
977871057 4:102091341-102091363 AATTAGCTGTGGGAGGTGGCGGG + Intergenic
977995331 4:103493461-103493483 GATTACAGATAGGAGGTGAGGGG + Intergenic
981786715 4:148487813-148487835 AATTATTTATAGGGGATGGGAGG - Intergenic
981823207 4:148909951-148909973 AATTACCTTGAGGAAATGGGAGG - Intergenic
983246237 4:165290816-165290838 AATTAGCTAGATGAGGTGGCAGG + Intronic
985200164 4:187476370-187476392 AAGTACCTATTGTATGTGGGAGG - Intergenic
986839508 5:11680060-11680082 AATTAACTAGGGGACGTGGGTGG + Intronic
988935955 5:36083160-36083182 ACACACCTATAGGAGGTGGCTGG - Intergenic
989273320 5:39557198-39557220 AAATCCCTATCTGAGGTGGGGGG + Intergenic
989291051 5:39766484-39766506 TATTATTTATGGGAGGTGGGTGG - Intergenic
992176432 5:74153854-74153876 AATCACCTGTGGGAGGGGGGAGG + Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993494052 5:88587247-88587269 ACACACCTATAGGAGGTGGCTGG - Intergenic
993574006 5:89579004-89579026 GATTACCTTCAGGAGTTGGGAGG + Intergenic
995772787 5:115690555-115690577 TGTTCCCTCTAGGAGGTGGGGGG + Intergenic
998753627 5:145352127-145352149 TATTGCCTAGAGGAGGTGTGAGG - Intergenic
999666177 5:153916295-153916317 ATGTACCTGTAGGAGGTGGCTGG + Intergenic
1000199022 5:158989131-158989153 AATTAGGTGTTGGAGGTGGGTGG - Intronic
1000509729 5:162165747-162165769 ACACACCTATAGGAGGTGGCTGG - Intergenic
1000947641 5:167441047-167441069 CATTACCTCTAGGAGTGGGGTGG - Intronic
1001253281 5:170165041-170165063 AATTACCCAGAGGAGGCGGGAGG + Intergenic
1003109746 6:3243563-3243585 AATTCCCTATAGTAGTTGGAGGG - Intronic
1004345052 6:14841646-14841668 AATTACCTAGACGTGGTGGCAGG - Intergenic
1006054198 6:31369050-31369072 ACAAACCCATAGGAGGTGGGGGG + Intergenic
1009289687 6:61867865-61867887 ACGTACCTGTAGGAGGTGGCTGG + Intronic
1009716398 6:67402891-67402913 AATTATGTATGGGGGGTGGGGGG - Intergenic
1009932266 6:70190427-70190449 GATTCCCCATAGTAGGTGGGAGG - Intronic
1011127779 6:84025159-84025181 AATTACCAGTGGGAGGTGGGAGG + Intergenic
1011370574 6:86633183-86633205 ACTCACCTGTAGGAGGTGGCTGG + Intergenic
1011704981 6:89992114-89992136 GATTACCTATAGAAAGTAGGTGG - Intronic
1014862857 6:126491681-126491703 AATTAGCTGGAGGTGGTGGGAGG - Intergenic
1014970358 6:127807210-127807232 AATTACCTGGACGTGGTGGGGGG + Intronic
1015476174 6:133660889-133660911 AATGACCTTGAGGAGGTGGATGG - Intergenic
1015553299 6:134434705-134434727 ATTTCCCTGAAGGAGGTGGGAGG + Intergenic
1015848332 6:137545731-137545753 AATGACTTATAGGACATGGGAGG - Intergenic
1018691489 6:166347621-166347643 ATTTACCTATAGGGGATGGGTGG - Intergenic
1021883743 7:25118466-25118488 AATTACCTAGGGGTGGGGGGCGG - Intergenic
1022255310 7:28650595-28650617 AATTTCCTATGGAAGGTTGGGGG - Intronic
1022325153 7:29324076-29324098 AATCACTTTTGGGAGGTGGGGGG + Intronic
1022419682 7:30208866-30208888 AAATGCCTATAGGAGTTGGTAGG - Intergenic
1027224667 7:76236427-76236449 AATTCCCTACACGGGGTGGGGGG + Intronic
1028493175 7:91436714-91436736 CATTGCCTTTAGGAGGAGGGAGG - Intergenic
1029207073 7:98876087-98876109 AATTAACTATGGGAGGTGGGGGG + Intergenic
1032480346 7:132241015-132241037 AATTACCAGGAGGAAGTGGGAGG + Intronic
1032537789 7:132678847-132678869 AGTTAACTATGGGAAGTGGGTGG + Intronic
1034106800 7:148497242-148497264 AATCCCCTCCAGGAGGTGGGTGG + Intergenic
1035155190 7:156906437-156906459 AAATACCAAGAGGATGTGGGGGG - Intergenic
1037198481 8:16221244-16221266 ACATACCTGTAGGAGGTGGCTGG - Intronic
1037451514 8:19020355-19020377 AAACACCTAAAGGAGGTGAGGGG + Intronic
1039986985 8:42455902-42455924 AATTACCAAGAGTAGTTGGGAGG + Intronic
1040404614 8:47087549-47087571 ACACACCTATAGGAGGTGGCTGG + Intergenic
1042864334 8:73344268-73344290 AATTACCAATAAGAGGTTGCAGG - Intergenic
1042934556 8:74045767-74045789 AGTTACATAAAGGAGGTAGGGGG - Intergenic
1043363126 8:79499254-79499276 ACATACCTGTAGGAGGTGGCTGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1051437555 9:17049025-17049047 ACTTACCTGTAGGAGGAGTGAGG - Intergenic
1052710016 9:32042602-32042624 AATTCAGAATAGGAGGTGGGTGG - Intergenic
1053507710 9:38658133-38658155 AATGGCTTAGAGGAGGTGGGAGG + Intergenic
1054922040 9:70552779-70552801 GATTGCCTATAGGAAGTGGTAGG + Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1056596497 9:88012094-88012116 AGTTACCTATTGGAGGGGAGGGG + Intergenic
1057111048 9:92471584-92471606 AATTACTTAAAGGAAATGGGTGG - Intronic
1058461724 9:105189777-105189799 ACATACCTGTAGGAGGTGGCTGG + Intergenic
1059076376 9:111197623-111197645 ACTGACCTGTAGGAGGTGGCTGG - Intergenic
1059509925 9:114835847-114835869 ATGTACCTGTAGGAGGTGGCTGG + Intergenic
1059821887 9:117982800-117982822 CATTCCTCATAGGAGGTGGGTGG - Intergenic
1059940633 9:119356082-119356104 AATAACCAATAGGAAGTAGGGGG - Intronic
1060795542 9:126510383-126510405 AATTAGCTAGATGAGGTGGCAGG - Intergenic
1186260682 X:7775746-7775768 AATTAATTATAAGAGGTGAGAGG - Intergenic
1186964365 X:14772023-14772045 ACATACCTGTAGGAGGTGGCTGG + Intergenic
1187386915 X:18857427-18857449 AATTAGCTAGAGGTGGTGGTAGG - Intergenic
1187654002 X:21448844-21448866 AATTACCTATCTGATGTTGGTGG - Intronic
1188869754 X:35359391-35359413 ACACACCTATAGGAGGTGGCTGG + Intergenic
1191930237 X:66364646-66364668 AAGCACCTGTAGGAGGTGGCTGG + Intergenic
1193933108 X:87581440-87581462 ACGCACCTGTAGGAGGTGGGTGG - Intronic
1195473549 X:105260060-105260082 AGTCACCTGAAGGAGGTGGGTGG + Intronic
1195626347 X:107008442-107008464 AATCACCTATAGTAGGTCTGGGG - Intergenic
1196061491 X:111412303-111412325 AATTAATCATAGGAGGTTGGGGG - Intronic
1198542485 X:137654466-137654488 AATGAAGTAAAGGAGGTGGGTGG - Intergenic
1201225933 Y:11819307-11819329 AATTACAAATATTAGGTGGGAGG + Intergenic
1201862477 Y:18614600-18614622 AATTAGCTTTATGTGGTGGGTGG - Intergenic
1201870846 Y:18705780-18705802 AATTAGCTTTATGTGGTGGGTGG + Intergenic