ID: 953522669

View in Genome Browser
Species Human (GRCh38)
Location 3:43657845-43657867
Sequence CTGCTTTCAAAGATGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953522669_953522671 0 Left 953522669 3:43657845-43657867 CCAAATTCCATCTTTGAAAGCAG 0: 1
1: 0
2: 2
3: 46
4: 336
Right 953522671 3:43657868-43657890 CTATGTTTTTATTTATTGTGTGG 0: 1
1: 0
2: 6
3: 77
4: 1192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953522669 Original CRISPR CTGCTTTCAAAGATGGAATT TGG (reversed) Intronic
903041031 1:20530799-20530821 CTGCTTTCACAGTGGGAGTTGGG + Intergenic
905473162 1:38207976-38207998 CTGCTTTCAGAGAAGGACATAGG - Intergenic
905956035 1:41996889-41996911 CTGCCTTCAAAGATGGTAGAAGG - Intronic
906131160 1:43457933-43457955 CTGCCTTCATAGAATGAATTAGG - Intergenic
906433456 1:45775047-45775069 CTGGTCTCATAGATGGAGTTGGG - Intergenic
906683718 1:47749010-47749032 ATTCTTTGAAAGATGGAGTTGGG + Intergenic
907938431 1:59063873-59063895 CTGCTGACAAAGAAGGAATTTGG + Intergenic
908156930 1:61363181-61363203 TTGGTTTCAAATATGGATTTTGG - Intronic
908212586 1:61916786-61916808 CTTCTTTCAAAGATAGTTTTGGG + Intronic
908696341 1:66846411-66846433 CAGCTTTCAAAGATGGATTAAGG - Intronic
909532471 1:76696316-76696338 CTGCTTTTAAAGATTTATTTAGG - Intergenic
909703828 1:78556920-78556942 CTGGTTTCATAGAATGAATTAGG - Intergenic
910918381 1:92316140-92316162 ATGATTTTAAAGATGAAATTGGG + Intronic
911096558 1:94059973-94059995 CTCTTTTAAAGGATGGAATTTGG - Intronic
911863151 1:102980965-102980987 CTGCTTTCAAATTGGGAATAGGG - Intronic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
913018608 1:114764393-114764415 CTGCTTTCACAGCTGGCGTTAGG - Intergenic
913367209 1:118052938-118052960 CTACTCTCAAAGATGCAGTTAGG + Intronic
916487471 1:165272392-165272414 CTGCTTTCAATGAGTGAATGAGG - Intronic
916707009 1:167361675-167361697 CTGCTTTCATAGAAGAAGTTAGG + Intronic
917698504 1:177555467-177555489 CTGCATTCAAAGGTGCAATGGGG + Intergenic
917763104 1:178185890-178185912 CTGGCTTCATAGATTGAATTAGG + Intronic
917898172 1:179513569-179513591 CTGCCTTCATAGAATGAATTAGG + Intronic
918653497 1:186995595-186995617 CTCCTTTCAAAAATGCAAATTGG + Intergenic
920078399 1:203353811-203353833 CTGCTTTCAGCCAAGGAATTAGG + Intergenic
921525202 1:216209080-216209102 CTGCTTACAAAGTTGGCCTTTGG - Intronic
922396545 1:225207738-225207760 CTGGTTTCAGAGAGAGAATTGGG - Intronic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
923065229 1:230511266-230511288 CTTCTTTAAAAGATATAATTTGG - Intergenic
1063153174 10:3355136-3355158 CTGCCTTCAGAGATGGAGTCAGG + Intergenic
1063737396 10:8775328-8775350 TGGCTTTCAAGGATGGGATTTGG - Intergenic
1065237126 10:23664223-23664245 CTGCCCTCACAGAAGGAATTTGG - Intergenic
1065287902 10:24202859-24202881 CTTCTTTCAACTATAGAATTGGG - Intronic
1066374792 10:34848127-34848149 CTTCTTTCAAAGTTGGAGTCTGG + Intergenic
1067522697 10:47020247-47020269 CTCATTTCAAAGATGGACATGGG + Intergenic
1067672616 10:48338084-48338106 CTGGTTTCAAAGAATGAGTTAGG - Intronic
1067897073 10:50194152-50194174 GTGCTTTCAAAGAATGAGTTGGG - Intronic
1067951899 10:50747888-50747910 GTGCTTTCAAAGAATGAGTTGGG + Intronic
1069927117 10:71858465-71858487 CTGCTTTCAAAGTTGGCTCTTGG + Intergenic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071484968 10:86093832-86093854 CTGGCTTCAAAGAATGAATTAGG - Intronic
1072402213 10:95115797-95115819 CAGCCTACCAAGATGGAATTAGG - Intergenic
1072760460 10:98052109-98052131 ATGCTTTGAAAGAAGGAAATGGG - Intergenic
1073408406 10:103318874-103318896 CTGCTTACAAAGCTGGCCTTTGG - Intronic
1073456965 10:103643198-103643220 CTCCTTTCCCAGTTGGAATTTGG + Intronic
1073726308 10:106235116-106235138 CTGATTTAAAAGGTGTAATTAGG + Intergenic
1075103223 10:119520110-119520132 CTTCTTCCAGAGATGGAATGTGG + Intronic
1076120047 10:127928728-127928750 GTGCTTTCCAAGATGTTATTTGG - Intronic
1078348799 11:10575370-10575392 CTGTTTTCAAAGAGAGAATAGGG + Exonic
1079083523 11:17429879-17429901 ATGGGTTCAAAGATGGAATGGGG - Intronic
1079572615 11:21963283-21963305 GAGCTTTTAAAGATGGAATATGG - Intergenic
1079648728 11:22899549-22899571 CTGCTTTGGAAGATAGAATGGGG + Intergenic
1080154705 11:29096113-29096135 CTGCTTTCCAAAGTGGAAATGGG - Intergenic
1080212277 11:29799986-29800008 CTACTTTAAAAGTTGGAATCTGG - Intergenic
1080397648 11:31904792-31904814 TTCCTTTCAAAGCAGGAATTGGG + Intronic
1080933037 11:36833442-36833464 CTGGCTTCATAGATTGAATTAGG + Intergenic
1081855739 11:46302349-46302371 TTGCTTTAAAGGATGGAGTTAGG - Intronic
1082990897 11:59206406-59206428 CCACTTTCAAAGGGGGAATTGGG - Exonic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085261304 11:75206441-75206463 ATGGTTTCAAAAATGGAATAAGG + Exonic
1085574288 11:77588934-77588956 CTGCTTTGAAAGCAGGAATACGG - Intronic
1085737243 11:79049551-79049573 CTGCTTGCAAAGCTGGCCTTGGG + Intronic
1087525733 11:99309604-99309626 CTGCTATCAAAGACGGAATGTGG - Intronic
1089188633 11:116637947-116637969 CTGCTTGCAAAGAAGAAATAAGG + Intergenic
1090023501 11:123148231-123148253 TGGCTTTCAAAGCTGGCATTTGG + Intronic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1091176636 11:133564181-133564203 ATGCTTTAAAAAATGGAATGTGG - Intergenic
1093268926 12:17034602-17034624 CTAATTGCAAAGTTGGAATTTGG + Intergenic
1094768877 12:33630150-33630172 CTGCTTTCAAATATGTTTTTTGG - Intergenic
1095377959 12:41554106-41554128 CTTCTTTTAAATATGCAATTAGG + Intronic
1095733052 12:45526098-45526120 CTGCCTTCATAGAATGAATTAGG - Intergenic
1095915943 12:47478677-47478699 CTGGCTTCAAAGAATGAATTAGG - Intergenic
1097601848 12:61702906-61702928 CTGCTTTAAAAGAAAGAATGTGG + Intergenic
1097612122 12:61836624-61836646 CTGCTTTCAAAGAAGCAGTTTGG - Intronic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099377070 12:81904647-81904669 CTGCTGTCAAAGAGTGTATTTGG - Intergenic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1100564703 12:95784167-95784189 CAATTTTCAAAGATGGAAATTGG + Intronic
1101031871 12:100668593-100668615 CTGCTTTAAATGATGTAAGTTGG + Intergenic
1101410608 12:104464669-104464691 CTGCTTTAAAAATTGGAAATGGG - Intronic
1103091669 12:118102491-118102513 CTGCTTTCCCAGTTGGAATTGGG - Intronic
1105986048 13:25568152-25568174 CTGATAGCCAAGATGGAATTTGG + Intronic
1106707319 13:32295212-32295234 CTGCTTCCAAAGATGTCATTGGG - Exonic
1106836968 13:33645027-33645049 TTGCTTCCAAAGATGGAAGCAGG + Intergenic
1107474604 13:40723258-40723280 TTGCTTTCAACGATAGAATATGG - Intergenic
1109706144 13:66095013-66095035 CTGGTTTCGAAGATGGAAGAAGG + Intergenic
1111424174 13:88057994-88058016 CTGCAATTCAAGATGGAATTTGG - Intergenic
1112571636 13:100598578-100598600 CAGCTCTCAAAAATGCAATTTGG + Intergenic
1112721527 13:102251453-102251475 ATGTTTTAAAAGATTGAATTTGG - Intronic
1114843302 14:26291203-26291225 CTGCTTTCAAGGCTGGTGTTGGG + Intergenic
1115318754 14:32055455-32055477 GTACTTTCAAACATTGAATTAGG - Intergenic
1115589827 14:34853414-34853436 ATGCTTTCAAAGAAGCAATCAGG - Intronic
1116796809 14:49399961-49399983 CTGGTTTGGAAGATGGAAGTGGG + Intergenic
1116918870 14:50551511-50551533 CTGCCTTCAAAGAATGATTTAGG - Intronic
1117310137 14:54513163-54513185 AAACTTTCAAAGATAGAATTTGG + Intronic
1117472276 14:56057821-56057843 TTGATTTGAGAGATGGAATTGGG - Intergenic
1117820881 14:59647591-59647613 CTGCTATCCAAGAGTGAATTTGG - Intronic
1118157735 14:63257584-63257606 GTGCTTTCAAAGATGGATTCAGG + Intronic
1118343620 14:64917130-64917152 CTTATTTCAAAGAAAGAATTAGG + Intronic
1119258669 14:73222896-73222918 CTGCCTTCCAACATTGAATTTGG + Exonic
1119828732 14:77681644-77681666 CTGCTTACAAAGATGGTCCTTGG + Intronic
1120261626 14:82192254-82192276 CTGGTTTCAAAGAAGGAAGATGG + Intergenic
1120383310 14:83810686-83810708 CTGGCTTTGAAGATGGAATTAGG - Intergenic
1120715509 14:87837014-87837036 CTGCTTTCACAGTGGGAATAAGG - Intergenic
1121892021 14:97603271-97603293 CTGATTGCAAAGTTGGAAGTAGG - Intergenic
1121922015 14:97890714-97890736 CTGATTTCATTGAAGGAATTTGG - Intergenic
1123828752 15:24110958-24110980 CTGTTATCAAAAATGGATTTTGG + Intergenic
1123843665 15:24274391-24274413 CTGTTATCAAAAATGGATTTTGG + Intergenic
1123918614 15:25055183-25055205 CTGCTTTCAAAGCAGGAAAGAGG - Intergenic
1123920424 15:25066022-25066044 CTGCTTTCAAAGCGGGAAATGGG - Intergenic
1124394167 15:29286546-29286568 CTGCTTTGAACAATGGAATGCGG + Intronic
1125423401 15:39526707-39526729 CAGCTTTCAAATATGGACTTTGG - Intergenic
1126706396 15:51409833-51409855 CCGCTTCCAAAGATTGGATTTGG + Intergenic
1126731757 15:51690586-51690608 CTGCTTTAAAAGATGGCAGCTGG - Intronic
1127064616 15:55223584-55223606 CTTCTTTCCAAGATGCAAATAGG - Intronic
1129206882 15:74042499-74042521 CTGCTCAGAAAGATGAAATTAGG + Intronic
1130313261 15:82772616-82772638 CTGCTTTCATTGATGGTATGGGG + Intronic
1131358133 15:91764163-91764185 TTGCTTTCAAGGAAGGAATTTGG - Intergenic
1131693451 15:94851053-94851075 CTGCCTTCATAGAATGAATTAGG + Intergenic
1132323862 15:100949514-100949536 CTGGTTTCATAGACTGAATTGGG - Intronic
1132978676 16:2723220-2723242 CTCCCTTCAAAAATAGAATTGGG + Intergenic
1133116783 16:3582137-3582159 CTGCTTTCTAGGGTGGCATTTGG - Exonic
1133386045 16:5371254-5371276 GTGGTTTCAAAGAGGGCATTAGG + Intergenic
1134759188 16:16698464-16698486 CTTCATTAAAAGAGGGAATTTGG + Intergenic
1134760133 16:16707151-16707173 CTGCATTGAAAGTTGGGATTTGG - Intergenic
1134985938 16:18652054-18652076 CTGCATTGAAAGTTGGGATTTGG + Intergenic
1134986885 16:18660720-18660742 CTTCATTAAAAGAGGGAATTTGG - Intergenic
1136715083 16:32273367-32273389 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1136752832 16:32656364-32656386 CTGGTTTCAAAGAATGAGTTAGG + Intergenic
1136815282 16:33214001-33214023 CTGGTTTCAAAGAATGAGTTAGG - Intronic
1136821758 16:33324081-33324103 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1136828321 16:33380620-33380642 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1136833387 16:33479392-33479414 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1137328120 16:47461533-47461555 CTGCTTTCTAAGGAGGAACTCGG - Intronic
1137601915 16:49762110-49762132 CAGCTTTTAAATATGGATTTGGG - Intronic
1138084238 16:54119276-54119298 ATCCTTTCAAATAGGGAATTCGG + Exonic
1141270412 16:82535140-82535162 TTGTTTTCTGAGATGGAATTTGG + Intergenic
1141593443 16:85083427-85083449 CGGCTTTCAAAGGAGGACTTAGG + Intronic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1202993859 16_KI270728v1_random:36976-36998 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1203011529 16_KI270728v1_random:245129-245151 CTGGTTTCAAAGAATGAGTTAGG + Intergenic
1203054969 16_KI270728v1_random:916402-916424 CTGGTTTCAAAGAATGAGTTAGG + Intergenic
1144242944 17:13331887-13331909 CTGGATTTAAAGATGGAATGAGG + Intergenic
1144485895 17:15664037-15664059 TTGCTTTCATAGATGGATCTCGG - Intronic
1145387397 17:22425789-22425811 CTGATTTCATAGATTGAGTTGGG + Intergenic
1145891038 17:28415981-28416003 CTTCTCTCAAAGGTGGAACTGGG + Intergenic
1146072009 17:29691141-29691163 TTGCTTTCTAAAATGGAAATTGG - Intronic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1149152715 17:53588459-53588481 CTGGTTTCATAGAATGAATTAGG - Intergenic
1151856431 17:76725578-76725600 CTGCTGTCAAAGATGTAAAGGGG + Exonic
1203172764 17_GL000205v2_random:165490-165512 ATGCTTTCAAAGATATAATGTGG - Intergenic
1154498752 18:14982808-14982830 CTGCTTTCATAGAATGAATCAGG - Intergenic
1155184710 18:23377009-23377031 GTGCTTTGATAGATGGATTTAGG - Intronic
1155229667 18:23760014-23760036 CTGCTTTCAAACACTGATTTAGG + Intronic
1155721005 18:29012135-29012157 CTTATTTCAAAAATGGAAATTGG - Intergenic
1157192397 18:45592473-45592495 CTGCTTCCCAAGATGGGACTGGG - Intronic
1157331773 18:46709224-46709246 CTGCCCTCAATGATGGGATTAGG + Intronic
1159733006 18:72055192-72055214 CTGAAGTCAAAGGTGGAATTAGG - Intergenic
1159918399 18:74205519-74205541 CTGCTTTCCCAGATGCAATCAGG + Intergenic
1160066260 18:75576850-75576872 CTTCTTTGAAAGATGGCCTTTGG + Intergenic
1160628763 18:80230979-80231001 CTGAATTCAAAAAGGGAATTTGG + Intronic
1162889150 19:13719787-13719809 CTGCTATCAAACATGGAATATGG + Intergenic
1163322483 19:16582784-16582806 CTGCTTTCCAGCATGGAAGTCGG - Intronic
1166017210 19:39991324-39991346 CAACTTTCCAAGATGGAATCCGG + Intronic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
925639660 2:5975210-5975232 CTACTTTAAAACAGGGAATTTGG - Intergenic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
926462232 2:13145252-13145274 CTGTTTTTAAAGAGGGACTTGGG + Intergenic
926762816 2:16294251-16294273 CTGCTTTAAAAGAAGATATTTGG + Intergenic
926995521 2:18731071-18731093 CTGAATTCAAAGATGAAATGTGG + Intergenic
927242111 2:20928353-20928375 CTGCTCTCAAGGCTGGCATTTGG + Intergenic
927655135 2:24938836-24938858 GTGCTTTAGAATATGGAATTTGG - Intergenic
928188594 2:29139486-29139508 CTGCTTTCATAGAATGAATTAGG + Intronic
928393334 2:30925911-30925933 ATGCTTTCAAACAGGGAAGTGGG + Intronic
930406061 2:50957008-50957030 ATGCCATGAAAGATGGAATTGGG + Intronic
931465810 2:62485975-62485997 CTGCTTACTAAAATGGAAATGGG - Intergenic
931509325 2:62973256-62973278 CTTCTTACATAGCTGGAATTTGG - Intronic
931779450 2:65566778-65566800 CTGCTTGCTCAGATGGATTTGGG + Intergenic
932118615 2:69077556-69077578 AGGCTTTGAGAGATGGAATTGGG - Intronic
934564957 2:95333743-95333765 CTGCGTTCAGTGAGGGAATTGGG - Intronic
937182593 2:120009988-120010010 CTCCTATCAAAGATGGAACTGGG - Intergenic
938820794 2:134957717-134957739 CTGCTTTCAAAGATAAACCTAGG - Exonic
940157090 2:150668963-150668985 CTGGTTTCATAGAATGAATTAGG - Intergenic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
948443603 2:238014476-238014498 CCACTTTCAAAGATGTTATTTGG - Intronic
1169360670 20:4946207-4946229 CTGGTTTCTGAGATGGAACTTGG - Intronic
1169363874 20:4975234-4975256 CTGCATTCCCAGAAGGAATTGGG - Intronic
1169977073 20:11341488-11341510 ATGCTTTCTAAGATTGTATTAGG + Intergenic
1172813508 20:37668654-37668676 GTGCTTATAAAGATGGAATAAGG + Intergenic
1173129229 20:40372161-40372183 TTACCTTCAGAGATGGAATTTGG - Intergenic
1173941510 20:46914926-46914948 CTGCCTTCAAAGCTGGAGTATGG + Intronic
1174093645 20:48069972-48069994 TTGCTTCAAAAGATGGAAATTGG + Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174545102 20:51319192-51319214 CTGGTTTGAAACATGGAATAGGG + Intergenic
1175094724 20:56532312-56532334 CTGCTGTCAATGATGGTATGTGG + Intergenic
1175294237 20:57897435-57897457 CTTCTTTCGAAAATAGAATTTGG - Intergenic
1176328756 21:5527273-5527295 ATGCTTTCAAAGATATAATGTGG - Intergenic
1176399001 21:6293678-6293700 ATGCTTTCAAAGATATAATGTGG + Intergenic
1176438156 21:6695426-6695448 ATGCTTTCAAAGATATAATGTGG - Intergenic
1176462418 21:7022496-7022518 ATGCTTTCAAAGATATAATGTGG - Intergenic
1176485979 21:7404274-7404296 ATGCTTTCAAAGATATAATGTGG - Intergenic
1178310125 21:31523044-31523066 CTGCTTAAAAACATGGCATTGGG - Intronic
1181147002 22:20855911-20855933 CTGCTTACAAAGTTGGCCTTTGG - Intronic
1183266692 22:36831187-36831209 TTGCTTTCAACAATGGAATGGGG + Intergenic
1183998482 22:41654425-41654447 CAGCTGTGAAAGATGAAATTAGG - Intronic
949695086 3:6684872-6684894 CTTCTTTTAAAGATATAATTAGG + Intergenic
949991132 3:9580174-9580196 CTGCTTTCAAAGCTACATTTTGG + Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950700473 3:14742204-14742226 ATGCTGTCAAAGATGGTAGTAGG + Intronic
951038157 3:17956774-17956796 CAGCTTCCAATAATGGAATTTGG + Intronic
952610932 3:35207560-35207582 CTGGCTTCAAAGAGTGAATTAGG + Intergenic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
956742075 3:72282960-72282982 CTGCTTTCACAAATGGAATATGG + Intergenic
956807057 3:72825627-72825649 TTGCATTCAAAGTTGGAAATTGG + Intronic
956995368 3:74821149-74821171 CTGGTTTCATAGAATGAATTAGG + Intergenic
957121147 3:76094619-76094641 CTGCTTTCAAAGAAACAATGGGG - Intronic
958105331 3:89065293-89065315 CTGCTTTAAATGTTGGCATTAGG + Intergenic
958445673 3:94211587-94211609 CTGGTTTCATAGAATGAATTAGG - Intergenic
958778616 3:98514623-98514645 TTGCTTTCAAAGATTAAATAGGG + Intronic
958994416 3:100886590-100886612 CTGCTTTGCAAGATGAAAGTTGG + Intronic
959432037 3:106266160-106266182 CTTCTCTCAAAGATGGCTTTTGG + Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960024488 3:112992419-112992441 CTGCTTTTGAACATGGTATTGGG - Intronic
960524735 3:118696526-118696548 CTGGTTTCATAGAATGAATTAGG - Intergenic
961630883 3:128297492-128297514 CTGCTCTCATAGCTGGGATTGGG - Intronic
962977837 3:140461497-140461519 CTGCTTACAAAGGAGGAAATTGG + Intronic
963526665 3:146423778-146423800 CTGGTTTTAAAGATGGAAGGAGG + Intronic
964463295 3:156961242-156961264 CTGTTTTAAAAGATTCAATTAGG - Intronic
965430408 3:168580253-168580275 ATGCTTAAAAATATGGAATTTGG - Intergenic
965670144 3:171139676-171139698 CTGCTTTGTAAGAAGGTATTTGG - Intronic
966160306 3:176960598-176960620 CTTAATTCAAAAATGGAATTTGG - Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
966991835 3:185240273-185240295 CTGCTTTCATAGAATGATTTAGG + Intronic
969462391 4:7335686-7335708 CTGCTCTCAAGAATGGCATTTGG + Intronic
970618966 4:17797448-17797470 CTGCATTCAAAGAAGGAAACTGG + Intergenic
970731405 4:19107932-19107954 CTGGTTTCAAAGATGGAAAGGGG + Intergenic
970926293 4:21456281-21456303 CCGACTTCAAAGATGCAATTTGG - Intronic
971900775 4:32655302-32655324 CTGGTTTCATAGAATGAATTAGG + Intergenic
972680524 4:41302201-41302223 CTGGTTTCATAGAATGAATTAGG + Intergenic
974095359 4:57357837-57357859 CTGCTTTCTGAGAAGGAAATGGG - Intergenic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
975347412 4:73308529-73308551 CTGCTGACAAAAATAGAATTTGG - Intergenic
977875072 4:102140020-102140042 CTGCTTTCACAGATAGACATAGG + Intergenic
978806659 4:112807889-112807911 ATGCTTTGAAAAATAGAATTGGG + Intergenic
979579520 4:122340331-122340353 CCTCTCTCAAAAATGGAATTTGG - Intronic
980057793 4:128095711-128095733 TTTTTTTCAAAGATAGAATTTGG + Intronic
980515392 4:133851310-133851332 ATGCTTTCAAAGATGGCAAATGG - Intergenic
983270255 4:165552688-165552710 CTCCTTTCAAAGACAGATTTTGG + Intergenic
984399581 4:179244291-179244313 GAGCCTTCAAAAATGGAATTAGG - Intergenic
984722021 4:182981893-182981915 CTGGTTTCATAGAATGAATTAGG - Intergenic
985093201 4:186385070-186385092 CTGGTTTCATAGAATGAATTAGG - Intergenic
985237524 4:187892338-187892360 CTGTTTTCCAAGTTGTAATTAGG + Intergenic
986182521 5:5406672-5406694 ATGCTTACTAATATGGAATTTGG - Intergenic
987355447 5:17059767-17059789 CTGATTTCAAGGTTGGAAATTGG + Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987710274 5:21495442-21495464 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
988749340 5:34178731-34178753 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
989621496 5:43388866-43388888 CTGCATTCAAAGTTGAAATAAGG + Intronic
991737595 5:69641923-69641945 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991760599 5:69914502-69914524 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991786733 5:70203599-70203621 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991789171 5:70221649-70221671 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991813921 5:70496755-70496777 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991817052 5:70518039-70518061 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991839830 5:70789552-70789574 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991879178 5:71203984-71204006 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991881618 5:71222013-71222035 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992459977 5:76951797-76951819 CTGCTTACAAAGTTGGACTGTGG + Intergenic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993490542 5:88541441-88541463 CTCCTTTTAATGATGTAATTTGG - Intergenic
994422226 5:99535547-99535569 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
994460145 5:100061993-100062015 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994484293 5:100375418-100375440 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
996011055 5:118482321-118482343 CTGGTTTCATAGAACGAATTAGG - Intergenic
996601799 5:125273020-125273042 AAGCTTTCAGAGATGGAAGTTGG + Intergenic
996922376 5:128783769-128783791 CTGCTATCAAGGATGGAATTTGG - Intronic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
998014275 5:138720020-138720042 CTGCTTTCAAAGCTCGAAGTTGG - Intronic
999117768 5:149178873-149178895 CCTCTTCCAAAGAGGGAATTGGG + Intronic
999819044 5:155206499-155206521 CTGGTTTCATAGAATGAATTAGG - Intergenic
1002814196 6:663424-663446 CTGGTTTCATAGAATGAATTAGG - Intronic
1002939717 6:1705436-1705458 CTGCTCAGAAAGATGGGATTAGG - Intronic
1004615361 6:17282850-17282872 CTGCCATCAATGATGGGATTGGG - Exonic
1005547414 6:26885077-26885099 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1005892779 6:30153838-30153860 CTGCTTTAGAAGATGGGATGGGG - Exonic
1006050223 6:31336525-31336547 CTGCTTTCCCAGAGGAAATTAGG + Intronic
1006817517 6:36862555-36862577 CTACTTTCAAAGAAGGAAGATGG - Intronic
1009018177 6:57926144-57926166 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1009218452 6:60952036-60952058 CTGGTTGCAAAATTGGAATTTGG + Intergenic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1011635921 6:89373027-89373049 CTGCTATAAAAGATAGAATTGGG + Intronic
1012020455 6:93911558-93911580 CTGGTTTCAAAAATGTAATTTGG + Intergenic
1012545848 6:100418772-100418794 CTGCTTGGAAAGATGGATTATGG - Intronic
1012965436 6:105668336-105668358 CTCCTTTTAAAGTTAGAATTAGG + Intergenic
1013928255 6:115499234-115499256 TTGCTTTCCAATATGGAATAAGG + Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1015362077 6:132351646-132351668 CTGGTTTCATAGAATGAATTAGG + Intronic
1015496109 6:133885076-133885098 CTGCTTTCAAAGCTGTATTGTGG + Intergenic
1016096667 6:140045895-140045917 ATGCTTTCAAAAATGGGATCTGG - Intergenic
1016194076 6:141310348-141310370 CTGGTTTCAAAGATGTAAACTGG - Intergenic
1017165591 6:151405472-151405494 CTGCTTTTAAAGACAGCATTTGG - Intronic
1018963574 6:168466217-168466239 CTGCTTTGAAAGCTGAAACTGGG + Intronic
1018963587 6:168466303-168466325 CTGCTTTGAAAACTGGAACTGGG + Intronic
1020564828 7:9781941-9781963 CTGCTCTGAATGATGGAACTCGG + Intergenic
1022902714 7:34826463-34826485 CTGCTTTCCAAGTTGAAAGTAGG + Intronic
1023679853 7:42674280-42674302 CTCCTATAAAAAATGGAATTGGG - Intergenic
1024771147 7:52724657-52724679 CTTATTTGAAAAATGGAATTTGG - Intergenic
1025613309 7:63096772-63096794 CTGTTTTCAGAGATGGTCTTTGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1026544295 7:71308388-71308410 CTGCTTTCAAAAGAGGCATTGGG + Intronic
1027557196 7:79680046-79680068 CTGCTTTAAAATATGTAACTAGG + Intergenic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028811174 7:95088399-95088421 GTGCTTTCTAACATTGAATTTGG + Intronic
1029210711 7:98905957-98905979 CTGCTGTCAAAGATGCAGTCAGG - Intronic
1029991838 7:104969462-104969484 CTGGTTTGAAAAATGGAAATGGG + Intergenic
1030090208 7:105851580-105851602 CTGCTTTAAAAGTTGCATTTTGG - Intronic
1030265184 7:107613880-107613902 TTGATTTGAAAGATGGAAATGGG + Intronic
1032255438 7:130293414-130293436 CTGATTTCACAGATGAAATGGGG - Intronic
1032709734 7:134451296-134451318 TCGCTTTCAAGGATGGAACTTGG - Intronic
1033583020 7:142753604-142753626 CTGCTCACAGAGATGGAACTAGG - Intronic
1033584569 7:142764526-142764548 CTGCTCACAGAGATGGAACTAGG - Intergenic
1033586047 7:142775081-142775103 CTGCTCACAGAGATGGAACTAGG - Intergenic
1034201937 7:149288102-149288124 CTGCTTTGGAAGATGGAATGGGG + Intronic
1034458810 7:151186862-151186884 CTGGTATCAAAGACGGAATCAGG + Exonic
1034712479 7:153205899-153205921 CTGATTTCAGAAATTGAATTAGG + Intergenic
1035106838 7:156448160-156448182 CTGGTTTCAAGGATTGATTTAGG + Intergenic
1035283299 7:157791309-157791331 CTGTTTTCAAACATGGAATCGGG - Intronic
1036462859 8:8969526-8969548 CTGTTCTAAAAGATGGAACTTGG + Intergenic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1039259746 8:35758447-35758469 GTGATTTCAAAAATGGACTTAGG + Intronic
1039775632 8:40733203-40733225 CTGCTTGCAAAGATGAATTCAGG - Intronic
1039949304 8:42155470-42155492 CTGCTTGCAAAGATGAGATTGGG + Intronic
1041832744 8:62174407-62174429 CTACTTTCAAAGATTGAACCAGG - Intergenic
1044176159 8:89125571-89125593 CTGCCATCAAAGATTGGATTAGG + Intergenic
1046087519 8:109456798-109456820 CTGCTTTCAAACATGTTCTTTGG - Intronic
1046695849 8:117338302-117338324 CAGCTCTGAAAGATGGGATTAGG - Intergenic
1046726239 8:117677459-117677481 CTGCTATAAAAAATGGAAGTAGG + Intergenic
1047150260 8:122252860-122252882 CCACTTTAAAAGGTGGAATTTGG + Intergenic
1048206433 8:132418917-132418939 TGGCTTTTAAAGATTGAATTAGG - Intronic
1049116471 8:140692757-140692779 TTGCTTTCAAATCTGGAATCTGG + Intronic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1052901789 9:33799742-33799764 CTGCTCACAGAGATGGAACTAGG - Intergenic
1053052198 9:34971363-34971385 CTGCTTTCAAGGATGGGCTGCGG + Exonic
1053590220 9:39506288-39506310 ATGTTTTCCAAGGTGGAATTTGG + Intergenic
1053847978 9:42260457-42260479 ATGTTTTCCAAGGTGGAATTTGG + Intergenic
1054576081 9:66859001-66859023 ATGTTTTCCAAGGTGGAATTTGG - Intronic
1056907859 9:90669577-90669599 CTGGTTTGAGTGATGGAATTGGG + Intergenic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1058108415 9:101002488-101002510 CTGGTTTTGAAGATGGAAGTGGG + Intergenic
1058472615 9:105296660-105296682 CTGCTTCCAAACAGAGAATTTGG - Intronic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1059960875 9:119563289-119563311 ATGCTTTCAAAGTTGGACTTGGG + Intergenic
1061532677 9:131227410-131227432 CTGCCTCCAAAGAAGAAATTTGG + Intronic
1061780929 9:132995625-132995647 CTGCTTCCAAGGATTGAATGGGG + Intergenic
1203433351 Un_GL000195v1:113189-113211 ATGCTTTCAAAGATATAATGTGG + Intergenic
1186169813 X:6864724-6864746 CTGGCTTCAAAGATGGAAGGAGG - Intergenic
1187222081 X:17337912-17337934 GAGTTTTCAAAGATGGAAGTGGG - Intergenic
1187694498 X:21905188-21905210 CTCCTTTCCAAGATGGCATCAGG + Intergenic
1187983688 X:24786944-24786966 CTGCTTTTAAAAAAGAAATTAGG - Intronic
1188119771 X:26289987-26290009 CTGGTTTCATAGAATGAATTAGG + Intergenic
1188557078 X:31424541-31424563 GTGCTTACAAAGATGGAAGATGG + Intronic
1189161544 X:38814134-38814156 GTCCTTTAAAAGATGGAAGTAGG + Intergenic
1190538378 X:51452008-51452030 TTGCTTTCAAAGATACAAATAGG - Intergenic
1190970040 X:55339855-55339877 ATGCTGTCAAATATGGAATTTGG - Intergenic
1191067414 X:56364941-56364963 CTGGTTTCATAGAATGAATTAGG + Intergenic
1191202667 X:57801485-57801507 CTGGTTTCATAGAATGAATTAGG - Intergenic
1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG + Intronic
1192534616 X:71916698-71916720 TGGCGTCCAAAGATGGAATTTGG + Intergenic
1192904041 X:75530638-75530660 CTGGTTTCATAGAATGAATTAGG + Intergenic
1192960429 X:76124677-76124699 GTGGTTTCAAGGATGGAATTGGG + Intergenic
1193526942 X:82603269-82603291 CTGGTTTCAAAGATTAAATTAGG - Intergenic
1193714079 X:84916777-84916799 TTGCTTTCATAGAATGAATTAGG - Intergenic
1193860367 X:86658445-86658467 CTGCCTTCAAAGAGAAAATTCGG - Intronic
1194283413 X:91981245-91981267 CTTCATTCAAAGATTGAATGGGG - Intronic
1194576625 X:95621120-95621142 CTGCTTCTCAAGATGGGATTTGG - Intergenic
1196032827 X:111109572-111109594 CTGATTTCAAGGGTGGAAGTAGG - Intronic
1198252088 X:134889768-134889790 CTGCTTTAAAAGATGGACAGGGG + Intronic