ID: 953526027

View in Genome Browser
Species Human (GRCh38)
Location 3:43690872-43690894
Sequence TGCGCGGAAGACGCATGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953526020_953526027 19 Left 953526020 3:43690830-43690852 CCGCGCACGCGCAAACGCGGGCG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 953526027 3:43690872-43690894 TGCGCGGAAGACGCATGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 17
953526023_953526027 -6 Left 953526023 3:43690855-43690877 CCGCCGGGCCGTGCTAGTGCGCG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 953526027 3:43690872-43690894 TGCGCGGAAGACGCATGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 17
953526025_953526027 -9 Left 953526025 3:43690858-43690880 CCGGGCCGTGCTAGTGCGCGGAA 0: 1
1: 0
2: 0
3: 2
4: 11
Right 953526027 3:43690872-43690894 TGCGCGGAAGACGCATGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953526027 Original CRISPR TGCGCGGAAGACGCATGCGC TGG Exonic
905909377 1:41643347-41643369 TGCGAGGAAGACCCGTGTGCAGG - Intronic
1112088185 13:96053454-96053476 GGAGCGGGACACGCATGCGCCGG - Intronic
1113737937 13:112690848-112690870 TGCGCGGAAGCCGCATCTGAAGG - Intronic
1121562431 14:94885304-94885326 TGTGAGGAAGACGCATGGGTGGG + Intergenic
1133121538 16:3611602-3611624 GGCGCGGGCGGCGCATGCGCAGG - Intergenic
1138156878 16:54713980-54714002 TGCGCAGATGAAGTATGCGCCGG - Intergenic
1143028439 17:3954187-3954209 TGAGCGGAAGGCGCCTGAGCTGG - Intronic
1151745542 17:76009874-76009896 TGCGCGGAGGAAGCAGGCGGAGG - Exonic
1165528807 19:36379267-36379289 TGCGCGGAGTGCGCATGCGCGGG + Intergenic
925342515 2:3147252-3147274 TCTGGGGAAGACGGATGCGCCGG + Intergenic
946358952 2:219207351-219207373 TGCGCAGAAGATGCCTGAGCAGG - Exonic
1184175593 22:42787112-42787134 TGAACGGAAGACGCCTGGGCTGG - Intergenic
952882605 3:37994209-37994231 TGCGGGGAAGACGGAGGTGCGGG - Intronic
953526027 3:43690872-43690894 TGCGCGGAAGACGCATGCGCTGG + Exonic
973907621 4:55546890-55546912 GTCGCTGACGACGCATGCGCCGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1047262394 8:123274474-123274496 CGCGCGGAGGACGCGCGCGCGGG - Exonic
1061672797 9:132198505-132198527 GGCGCAGCAGCCGCATGCGCAGG - Exonic
1190761557 X:53441800-53441822 TGAGCAGGACACGCATGCGCGGG - Intergenic