ID: 953528846

View in Genome Browser
Species Human (GRCh38)
Location 3:43719920-43719942
Sequence TTAGGGAATTTGTAGTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953528846 Original CRISPR TTAGGGAATTTGTAGTTGTT AGG Intronic
905918609 1:41703677-41703699 TTAGGGATTTTTTATGTGTTGGG - Intronic
909488019 1:76195864-76195886 TTAGGGAATTTGAAGGAGTATGG + Intronic
909917235 1:81335645-81335667 TTAGGGAAAATGGAGTTGTGGGG - Intronic
910854514 1:91682297-91682319 TTATGGAATTCTAAGTTGTTTGG + Exonic
911239770 1:95452460-95452482 TCAGGGAAATTGTAGCTTTTAGG - Intergenic
911239901 1:95453755-95453777 TCAGGGAAATTGTAGCTTTTAGG - Intergenic
912855231 1:113162797-113162819 TGAGGGAATTTGTTGCTGGTTGG - Intergenic
913292544 1:117287442-117287464 TTAGGGATTTAATAGTTGGTAGG - Intergenic
914976187 1:152365183-152365205 TTAGTGAAATTGTATTGGTTTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916925631 1:169517529-169517551 TTAGGGAATTTGGATTTAGTTGG + Intronic
917937134 1:179879589-179879611 TTAGGGAATTTGTCATTTATTGG - Intergenic
919197463 1:194306318-194306340 ATAGTTAATTTGTATTTGTTAGG + Intergenic
919970433 1:202573435-202573457 TTAGTGGAGTTATAGTTGTTTGG - Intronic
921113892 1:212068156-212068178 TTAGTGTAGTTGAAGTTGTTTGG + Intronic
921143683 1:212330795-212330817 TTAGGAAATTTTTGATTGTTGGG + Intronic
921795408 1:219337974-219337996 TGTGGGCATTTGTAGTTATTTGG + Intergenic
1064162682 10:12959532-12959554 TTGGGTAATTAGTAATTGTTGGG - Intronic
1064258335 10:13764535-13764557 TTAGTGAGTTTGTTGTTGTTAGG - Intronic
1064282347 10:13962607-13962629 TTACTTAATTTGTATTTGTTTGG - Intronic
1065018214 10:21480904-21480926 TTAAGGAATTTGTATCTGCTTGG + Intergenic
1068499855 10:57830949-57830971 TTAAGGAATTTATTGCTGTTTGG + Intergenic
1068588226 10:58824799-58824821 TGAGGGTATTTGCATTTGTTTGG + Intronic
1069312023 10:67049687-67049709 GTAGAGAATTTGTACTTGTCAGG - Intronic
1071593319 10:86897453-86897475 TTAGGGACTTAGAAGTTTTTTGG + Intronic
1074354827 10:112773441-112773463 TTCTGGAATTTGTGGTTGTGTGG - Intronic
1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG + Intronic
1078955951 11:16195381-16195403 TTAGGGAATTTCTAAAAGTTAGG + Intronic
1079881208 11:25929319-25929341 TTAGTTTATTTGAAGTTGTTTGG + Intergenic
1081360275 11:42168814-42168836 GTAGGGAAATTGTAGTTAATAGG - Intergenic
1082171582 11:49011602-49011624 TTATGGAAGTTTTAGTTATTTGG + Intergenic
1085591913 11:77770964-77770986 AGAGGGAATTTGTAGTACTTGGG + Intronic
1086694313 11:89825483-89825505 TTATGGAAGTTTTAGTTATTTGG - Intergenic
1086711833 11:90019028-90019050 TTATGGAAGTTTTAGTTATTTGG + Intergenic
1087745425 11:101939754-101939776 TTAAAGTATTTGAAGTTGTTTGG - Intronic
1089673134 11:120070837-120070859 TCAGAGAATTTCTAGTTGTTTGG - Intergenic
1092614580 12:10205082-10205104 TTAGTGAATTTGTCCTCGTTTGG - Intergenic
1093582838 12:20804045-20804067 TGAGGGAGTATGCAGTTGTTGGG + Intergenic
1097971900 12:65642080-65642102 TTCAGGAACTTGGAGTTGTTCGG + Intergenic
1101184361 12:102258535-102258557 TTATGTATTCTGTAGTTGTTTGG + Intergenic
1104843080 12:131833907-131833929 TTAGGGAATTTATGGTTTTTGGG - Intronic
1105886024 13:24642303-24642325 TTAGAGAATTTCCACTTGTTGGG - Intergenic
1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG + Intergenic
1106953661 13:34912143-34912165 TTAGGGCCTTTGGGGTTGTTGGG - Intergenic
1107677412 13:42811344-42811366 TGAAGGAGTTTGTTGTTGTTTGG + Intergenic
1108651242 13:52482068-52482090 TGAAGAAATTTGTAGTTCTTGGG + Intergenic
1109862522 13:68218980-68219002 TTCGTGAATTTGTTGTTGATTGG + Intergenic
1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG + Intergenic
1110374417 13:74776194-74776216 TTTAGGAATTTCTAGTTGATAGG - Intergenic
1110607992 13:77455816-77455838 ATATGTATTTTGTAGTTGTTGGG - Intergenic
1111098057 13:83540209-83540231 TCAGGGAATCTGAAATTGTTGGG + Intergenic
1111975717 13:94965300-94965322 TTAGGGAATTTGAGGAAGTTGGG + Intergenic
1112444329 13:99450419-99450441 TAAGGGGATTTTTAGATGTTAGG - Intergenic
1113123140 13:106946075-106946097 TTAGTGAAGTTGTACTTGTACGG - Intergenic
1113126728 13:106987474-106987496 CTGGGGAATTTGTTGTTGTTGGG + Intergenic
1113171339 13:107507221-107507243 TTAGGGATTTTCTAGTTGGCAGG + Intronic
1114876818 14:26730756-26730778 TTACAGAATTTGTTGATGTTAGG + Intergenic
1115911121 14:38256724-38256746 CTAAAGAATTTGGAGTTGTTTGG + Intergenic
1116211362 14:41950135-41950157 ACAGGGCATTTGAAGTTGTTTGG + Intergenic
1118101622 14:62611665-62611687 TTATGTATTTTGTAGGTGTTGGG - Intergenic
1118436225 14:65773064-65773086 TTAGGGAAGTTGTGGTTGTAAGG - Intergenic
1120772322 14:88393589-88393611 TGAGAGGATTTGTATTTGTTTGG + Intronic
1122871058 14:104639272-104639294 TCAGGGACTTTGGAGGTGTTGGG + Intergenic
1202942324 14_KI270725v1_random:163105-163127 TTACAAAATTTATAGTTGTTTGG + Intergenic
1125101253 15:35915160-35915182 TTAAGGTATTTGAAATTGTTAGG + Intergenic
1125915221 15:43480705-43480727 TTCAGGAATTTGTAGTTCATTGG - Intronic
1126337273 15:47599967-47599989 CTAGGGAATTTGTAGCATTTGGG + Intronic
1126464114 15:48944916-48944938 TTAGGACATTTGAAGTTGTTAGG - Intronic
1129339840 15:74878434-74878456 TGAGGGAGTCTGTAGTTGTGAGG - Intergenic
1129750836 15:78062333-78062355 TTAGTGACTTTGAAGTTGTTTGG - Intronic
1137893190 16:52183711-52183733 CCAGGTAATTTTTAGTTGTTGGG - Intergenic
1138987493 16:62348473-62348495 TTAGGTAATGTTTAGTTTTTTGG - Intergenic
1139323061 16:66130847-66130869 CTATGTAATTTGTAGTTTTTTGG - Intergenic
1141350831 16:83294380-83294402 GCAGGGAATTGGGAGTTGTTAGG - Intronic
1142774469 17:2125458-2125480 TTAGGAAATTTAAATTTGTTTGG - Intronic
1145744177 17:27301475-27301497 TTAGGACTTTTGTAATTGTTAGG + Intronic
1146384574 17:32358481-32358503 TAATGGAAATTGTTGTTGTTAGG + Exonic
1149874625 17:60219188-60219210 TTAAGGTTTTTGTTGTTGTTTGG - Intronic
1150088414 17:62296439-62296461 TTAAGGTTTTTGTTGTTGTTTGG - Intergenic
1150549571 17:66196779-66196801 TTAAGTCATTTGTAGCTGTTAGG - Intergenic
1153530131 18:6037846-6037868 TTAGGGAATATTTAGATGTTTGG + Intronic
1153854159 18:9128681-9128703 TTATGAAATTTGTACTTTTTGGG - Intronic
1153899574 18:9604762-9604784 TTAGGGAATTTATATATGTTGGG - Intronic
1155652382 18:28157572-28157594 TAATGGAAGTTGTAGTGGTTGGG - Intronic
1156846829 18:41675351-41675373 ATAGGGAATTTGTCCCTGTTTGG + Intergenic
1157381306 18:47220817-47220839 TTATTGAATTTGTGGTTGATAGG + Intronic
1157638526 18:49187302-49187324 TTGGGCAAGTTGTAGGTGTTAGG - Intronic
1158121679 18:54055577-54055599 TCAGGGAGTTTGTAGTCTTTTGG - Intergenic
1158451412 18:57569356-57569378 TTAGGGAAGTGGTTGTTGCTTGG - Intronic
1158720989 18:59924365-59924387 TTAGTTAATTTGCAGTTGTTTGG - Intergenic
1158769875 18:60502546-60502568 TTAGGGGATCTATATTTGTTTGG + Intergenic
1159239763 18:65727336-65727358 TTAGGGAATATGTATCTCTTAGG - Intergenic
925051948 2:822372-822394 TTAATTAATTAGTAGTTGTTTGG + Intergenic
925753108 2:7107680-7107702 TTAAGGAATTTTTTATTGTTAGG - Intergenic
926498275 2:13618683-13618705 ATAGGGAATTTGTACTGCTTGGG + Intergenic
929817384 2:45244694-45244716 TTAGGTATTTTGTAGTTTTGTGG - Intergenic
930145290 2:47996132-47996154 TCAGGGAATTTCTATTTCTTAGG + Intergenic
930348687 2:50220835-50220857 TTAGGGGAATTGTGGTTGTTTGG - Intronic
931878842 2:66544653-66544675 TTAAGAAATTTTCAGTTGTTCGG - Intronic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
935541801 2:104357034-104357056 TTAAAGAAATGGTAGTTGTTTGG - Intergenic
937839980 2:126515111-126515133 TTTTGGAATTTGTAGCTGGTGGG - Intergenic
938308826 2:130272022-130272044 CTAGGAAAATTGTAGTAGTTAGG - Intergenic
938445385 2:131373090-131373112 TCAGGAAATTAATAGTTGTTGGG + Intergenic
938446647 2:131385925-131385947 CTAGGAAAATTGTAGTAGTTAGG + Intergenic
939513203 2:143132793-143132815 TTATGGAATTTGAAGAAGTTGGG - Intronic
940086026 2:149860133-149860155 TTTGGTATTTTGTTGTTGTTTGG + Intergenic
940611832 2:156003102-156003124 AAAGGAATTTTGTAGTTGTTTGG + Intergenic
942607260 2:177705727-177705749 TTAGGAAATTGAGAGTTGTTGGG + Intronic
943060193 2:183035208-183035230 TTAGGGAACTTGTAGTTTGACGG - Intronic
944958034 2:204835298-204835320 TTTGGGAATTTATAGATGTGGGG + Intronic
945131853 2:206582186-206582208 TTAGGTCATTAGTAATTGTTTGG + Intronic
946611682 2:221465469-221465491 ATAGGGAAGTTGAAGGTGTTGGG + Intronic
947408115 2:229802515-229802537 TTAGGGATTTTGTAATGGTGGGG - Intronic
948324560 2:237103348-237103370 TTAGGAATTATGTAGTTGTCTGG + Intergenic
1169187299 20:3629490-3629512 TTGGAGAATTTGTTGTTGTCTGG - Intronic
1170193957 20:13671482-13671504 TTAGGGAATTTGTTGTTAGAAGG + Intergenic
1171005064 20:21456504-21456526 TTAGGGTTTTTATAGTTTTTGGG + Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1176087006 20:63301387-63301409 ATATGCAATTTGCAGTTGTTGGG + Intronic
1176580846 21:8523825-8523847 TTACAAAATTTATAGTTGTTTGG - Intergenic
1177407665 21:20691413-20691435 TTAGAGATTTTGTATTTGTCAGG - Intergenic
1181081641 22:20419511-20419533 TTAGTGAATTTGTGGTGGTTGGG - Intergenic
1182909587 22:33971028-33971050 TTAGGGAATTTCTTGCTGTGAGG + Intergenic
1183473911 22:38025503-38025525 TCAGGGAATTTGTGAATGTTGGG - Intronic
950204629 3:11069496-11069518 TTAGGGAAATTATATTGGTTAGG + Intergenic
950820872 3:15757241-15757263 TTAGGCTATTAGTAGTTTTTAGG + Intronic
951009514 3:17660122-17660144 TTAGGTATTTTGTAGTTGCTTGG - Intronic
951220800 3:20067093-20067115 TCAGGGAATTTTAATTTGTTTGG + Intronic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
957657507 3:83099725-83099747 GTAAGGAATTAGTAGTTATTTGG - Intergenic
957888046 3:86316367-86316389 TTAAGGCTTTTGGAGTTGTTAGG + Intergenic
958063745 3:88516471-88516493 TCAGGCATTTTGTAGTAGTTTGG - Intergenic
958089735 3:88861582-88861604 GTGGGGAATTGGTAGTTGATGGG - Intergenic
958104225 3:89052450-89052472 TTAGGGTTTTTATAGTTGATAGG + Intergenic
959188924 3:103084723-103084745 CCAGGGAAGTAGTAGTTGTTTGG + Intergenic
959494294 3:107031105-107031127 TTTTGGAATTTGCTGTTGTTTGG - Intergenic
960216251 3:115041750-115041772 ATAGGGAATTTATAGTTATTTGG - Intronic
960516647 3:118608965-118608987 TTAGGGATTTTGTCTTGGTTTGG - Intergenic
961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG + Intronic
963223638 3:142838251-142838273 TTATGGGACTTGTAGTGGTTTGG + Intronic
963235397 3:142950967-142950989 TTAGTGAATTTTTGGTTATTAGG + Intronic
963366659 3:144343979-144344001 TTAGGAAATTTTTACTTGATTGG + Intergenic
963557310 3:146808759-146808781 TCAATGAATTTGTAGTTTTTAGG + Intergenic
964549339 3:157869491-157869513 TTAGGGAATTTGAACTCCTTAGG + Intergenic
965865148 3:173196604-173196626 TGAGAGAACTTCTAGTTGTTGGG + Intergenic
966053488 3:175652383-175652405 ATATGGAATTTGTATTTGGTGGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
969974744 4:11087109-11087131 TCAGTGAATTTATTGTTGTTTGG - Intergenic
970958984 4:21850840-21850862 TGAGGGAATATGTAGTGTTTGGG - Intronic
971778575 4:31000541-31000563 TTAGGAAATTTGTTGTTTATGGG + Intronic
974162826 4:58162008-58162030 TTAAGTAATGTGGAGTTGTTGGG - Intergenic
974450997 4:62059117-62059139 CTAGGAAAATTGTACTTGTTTGG + Intronic
975695184 4:77005879-77005901 TTGGGGATTTTTTAGTTGTGGGG + Intronic
977569418 4:98614044-98614066 TTAGGCAGTTGGTGGTTGTTTGG - Intronic
979287534 4:118942787-118942809 TTAGATAATTTTTTGTTGTTAGG - Intronic
980204482 4:129699753-129699775 TTTGGGAATGTGTAGTTCTGTGG + Intergenic
980241707 4:130186003-130186025 TTATTGAATTTGTACTTATTTGG - Intergenic
980850834 4:138379408-138379430 TTAGGGAACCTCTAGTTTTTTGG + Intergenic
981857011 4:149306906-149306928 AAAGGAAATTTGTAGGTGTTGGG - Intergenic
982977577 4:162085342-162085364 TTAAAGAATTTATATTTGTTGGG - Intronic
983800719 4:171926496-171926518 TTATGGAATTTTTAGATTTTGGG + Intronic
983865889 4:172766239-172766261 TAAGGGAATTTTTAGGTTTTAGG + Intronic
984486934 4:180382530-180382552 TTTGGCAATATGAAGTTGTTGGG - Intergenic
985200771 4:187483059-187483081 TTCTGGAATTTACAGTTGTTTGG + Intergenic
987183619 5:15391597-15391619 TTATGGAATTTTTAGTCGTTTGG + Intergenic
987255476 5:16145990-16146012 TTATGGAATTTGTGAGTGTTGGG - Intronic
987769078 5:22277132-22277154 TTATCTAATTTGTAGTTATTGGG - Intronic
987882526 5:23767346-23767368 TTGAGGAATATGTAATTGTTTGG - Intergenic
988179342 5:27769498-27769520 TTAGAGTATGGGTAGTTGTTGGG - Intergenic
988599113 5:32623024-32623046 TTGGGGAGTTTTGAGTTGTTTGG + Intergenic
989092626 5:37749690-37749712 GTAGGGAATATTAAGTTGTTTGG - Intronic
989709300 5:44377932-44377954 GTAGGTAATCTGTGGTTGTTTGG + Intronic
990280124 5:54241268-54241290 TTAGGGATTTTTTAGATGTTAGG - Intronic
991609214 5:68433641-68433663 TGAGAGAATTTGTTGTTGTGAGG - Intergenic
992599996 5:78390178-78390200 TTGGGGAATTGGTTGGTGTTGGG + Intronic
992608492 5:78486597-78486619 TTAGGTAGTTTTTAGTGGTTTGG + Exonic
993510324 5:88763235-88763257 TTGGGGAATTTATAATTGGTGGG + Intronic
995158798 5:108950321-108950343 TTTGAGAATTTGAATTTGTTTGG - Intronic
995307624 5:110672546-110672568 TTTGGAAATTTGAAGTTGTTTGG - Intronic
995963618 5:117876107-117876129 TTAGAAAATTTGTAGTTAATTGG + Intergenic
997871567 5:137510159-137510181 TTTGGTTATTTGTAGTTCTTTGG - Intronic
998866015 5:146503594-146503616 TAAGGGTATATGTTGTTGTTGGG + Intronic
999277713 5:150342749-150342771 TGAGGTTATTTATAGTTGTTTGG - Intergenic
1000722780 5:164729232-164729254 TAAAGGAAGTAGTAGTTGTTGGG + Intergenic
1000951129 5:167484610-167484632 TAAGGGAATGTGTACTAGTTTGG - Intronic
1005289189 6:24361647-24361669 ATAGGGAATTTTAGGTTGTTTGG - Intergenic
1008241272 6:49115147-49115169 TAAGAGAATGTGTAGTTCTTAGG + Intergenic
1008842876 6:55925833-55925855 TTAGGGAATTTGCAGTCTTATGG - Intergenic
1009919876 6:70044225-70044247 TAAGGGAATTTGTGGCTATTTGG + Intronic
1011917989 6:92533639-92533661 TTTGTGTATTTGTAGCTGTTTGG - Intergenic
1011997956 6:93617273-93617295 TTAAGGAATTAGTGCTTGTTCGG - Intergenic
1012480963 6:99666501-99666523 TGAAAGAATTTGTAATTGTTGGG + Intergenic
1012702433 6:102477453-102477475 TTAGGGAATTTTTGGTTGGCAGG - Intergenic
1012837304 6:104285858-104285880 GTAGGGAATATGTATTTGTGTGG + Intergenic
1012848143 6:104415436-104415458 TCAAGGAACTTTTAGTTGTTTGG + Intergenic
1013112510 6:107075445-107075467 TAAGGCACTTTGTATTTGTTAGG - Intronic
1016629254 6:146208615-146208637 TTATGCATTTTGAAGTTGTTAGG + Intronic
1021049650 7:15966760-15966782 TTTGGGAATTTTTCTTTGTTTGG - Intergenic
1021932249 7:25593374-25593396 ATAGGGAGTTTGTAAATGTTTGG - Intergenic
1021978950 7:26036069-26036091 TTAGGGGTTTTTTAATTGTTTGG + Intergenic
1022328626 7:29356428-29356450 GTGGGGAATTTGTGGATGTTGGG - Intronic
1026494516 7:70890851-70890873 TTATGGATTTTGTGTTTGTTTGG - Intergenic
1026620527 7:71946137-71946159 TTAGGGAAATGGTAGATGTTGGG + Intronic
1026672404 7:72401680-72401702 TTTGGGAATTTGGAATTTTTTGG - Intronic
1028309567 7:89314193-89314215 TTATGGAAATTATAGATGTTTGG + Intronic
1030337828 7:108344663-108344685 TTAGGGAATTGGTATTTAATGGG - Intronic
1030739804 7:113095330-113095352 TTATAGAATTTGTAGATGTAAGG - Intergenic
1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG + Intergenic
1032462953 7:132125567-132125589 TTTGGGATTTTGGAGTTGTTTGG - Exonic
1040603314 8:48905671-48905693 TTAGGGAACTATGAGTTGTTTGG + Intergenic
1041057207 8:53998680-53998702 TGAGGGAATTCATATTTGTTGGG + Intronic
1041063654 8:54060483-54060505 TTATGGTAATTCTAGTTGTTCGG - Intronic
1041276829 8:56169018-56169040 TTGAAGAATTTGTATTTGTTAGG - Intronic
1041653419 8:60323586-60323608 TTAGGGTTTTTATAGTTTTTGGG + Intergenic
1041990230 8:63979534-63979556 TTCTGGAATTTGGAGTTATTTGG + Intergenic
1043719577 8:83530756-83530778 TTAGGTAAATTGTAGTTTTCTGG - Intergenic
1044682126 8:94792069-94792091 TTAGGTAACTTACAGTTGTTAGG + Exonic
1048037564 8:130692350-130692372 TGAAGGAATTTGTTTTTGTTTGG + Intergenic
1050890024 9:10812926-10812948 TTAAGGAATTTGAAGTTGTGAGG - Intergenic
1051278995 9:15422803-15422825 TGATGGAAGTTGTAGTTGCTTGG - Exonic
1052058822 9:23935198-23935220 TTATGGAATTTTAAGTTGTGAGG - Intergenic
1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG + Intronic
1056531194 9:87489311-87489333 TTAGGGGATTGGTTGTAGTTAGG + Intergenic
1056906819 9:90658385-90658407 TTAGGGAATTCGAAGTTTTTTGG + Intergenic
1060761961 9:126261009-126261031 ATATGGAATTTGTATTTATTGGG + Intergenic
1062256906 9:135629397-135629419 TTGGGTAATTTGTAGATGTGTGG - Intronic
1186669741 X:11757430-11757452 TTAGGGAATTTTTAGTCTATTGG + Intergenic
1187534684 X:20129702-20129724 TTATGGTATTTTTAGCTGTTGGG - Intronic
1187737531 X:22320223-22320245 TTAGGGGATTTGGGGTTTTTTGG - Intergenic
1188405668 X:29806268-29806290 GTAGGGAATTTGTAGTATGTAGG + Intronic
1188732768 X:33672262-33672284 TTTGGGAATGTGTAACTGTTGGG - Intergenic
1190561295 X:51688007-51688029 TTGGGTTATTTGTGGTTGTTTGG + Intergenic
1190562996 X:51705310-51705332 TTGGGTTATTTGTGGTTGTTTGG - Intergenic
1193767537 X:85548924-85548946 TAAGTGAAATTGTGGTTGTTAGG + Intergenic
1197334007 X:125189259-125189281 TGAGGGAAGTTGTACATGTTGGG - Intergenic
1200685936 Y:6258895-6258917 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1200991468 Y:9350142-9350164 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1200994124 Y:9370418-9370440 ATTGGGAATTTTTAATTGTTTGG - Intronic
1200996788 Y:9390753-9390775 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1200999303 Y:9459305-9459327 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1201001956 Y:9479616-9479638 ATTGGGAATTTTTAATTGTTTGG - Intronic
1201004623 Y:9499902-9499924 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1201007276 Y:9520228-9520250 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1201009916 Y:9540579-9540601 ATTGGGAATTTTTAATTGTTTGG - Intergenic
1201012486 Y:9561263-9561285 ATTGGGAATTTTTAATTGTTTGG - Intergenic