ID: 953530666

View in Genome Browser
Species Human (GRCh38)
Location 3:43737105-43737127
Sequence TATCCTATTCCCAGAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953530660_953530666 28 Left 953530660 3:43737054-43737076 CCAGGATAATCAGCTTCTCAGTG No data
Right 953530666 3:43737105-43737127 TATCCTATTCCCAGAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953530666 Original CRISPR TATCCTATTCCCAGAGGGTG AGG Intergenic
No off target data available for this crispr