ID: 953531157

View in Genome Browser
Species Human (GRCh38)
Location 3:43740830-43740852
Sequence ATGGTTAAGTGGATTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953531157_953531161 27 Left 953531157 3:43740830-43740852 CCATCATCAATCCACTTAACCAT No data
Right 953531161 3:43740880-43740902 ATCAGCATTGTTAACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953531157 Original CRISPR ATGGTTAAGTGGATTGATGA TGG (reversed) Intergenic
No off target data available for this crispr