ID: 953539822

View in Genome Browser
Species Human (GRCh38)
Location 3:43807712-43807734
Sequence TCAACCCCTTTTACAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953539821_953539822 -10 Left 953539821 3:43807699-43807721 CCAAATCAAGAATTCAACCCCTT No data
Right 953539822 3:43807712-43807734 TCAACCCCTTTTACAAGAGCTGG No data
953539819_953539822 12 Left 953539819 3:43807677-43807699 CCAACAACAACCAAGCAGAGAAC No data
Right 953539822 3:43807712-43807734 TCAACCCCTTTTACAAGAGCTGG No data
953539820_953539822 2 Left 953539820 3:43807687-43807709 CCAAGCAGAGAACCAAATCAAGA No data
Right 953539822 3:43807712-43807734 TCAACCCCTTTTACAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953539822 Original CRISPR TCAACCCCTTTTACAAGAGC TGG Intergenic
No off target data available for this crispr