ID: 953540616

View in Genome Browser
Species Human (GRCh38)
Location 3:43814519-43814541
Sequence CCAATCTCCCAGCCAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953540616_953540621 2 Left 953540616 3:43814519-43814541 CCAGGAGTTGGCTGGGAGATTGG No data
Right 953540621 3:43814544-43814566 GAGGGAATACTTTGTTGTCTGGG No data
953540616_953540623 13 Left 953540616 3:43814519-43814541 CCAGGAGTTGGCTGGGAGATTGG No data
Right 953540623 3:43814555-43814577 TTGTTGTCTGGGAGGCTCCCAGG No data
953540616_953540622 5 Left 953540616 3:43814519-43814541 CCAGGAGTTGGCTGGGAGATTGG No data
Right 953540622 3:43814547-43814569 GGAATACTTTGTTGTCTGGGAGG No data
953540616_953540620 1 Left 953540616 3:43814519-43814541 CCAGGAGTTGGCTGGGAGATTGG No data
Right 953540620 3:43814543-43814565 AGAGGGAATACTTTGTTGTCTGG No data
953540616_953540624 18 Left 953540616 3:43814519-43814541 CCAGGAGTTGGCTGGGAGATTGG No data
Right 953540624 3:43814560-43814582 GTCTGGGAGGCTCCCAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953540616 Original CRISPR CCAATCTCCCAGCCAACTCC TGG (reversed) Intergenic
No off target data available for this crispr