ID: 953541335

View in Genome Browser
Species Human (GRCh38)
Location 3:43821213-43821235
Sequence CCTTCATTCCCTGAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953541330_953541335 -3 Left 953541330 3:43821193-43821215 CCACTCCTGCTCTTGCAGACCCT No data
Right 953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG No data
953541328_953541335 -1 Left 953541328 3:43821191-43821213 CCCCACTCCTGCTCTTGCAGACC No data
Right 953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG No data
953541331_953541335 -8 Left 953541331 3:43821198-43821220 CCTGCTCTTGCAGACCCTTCATT No data
Right 953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG No data
953541329_953541335 -2 Left 953541329 3:43821192-43821214 CCCACTCCTGCTCTTGCAGACCC No data
Right 953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953541335 Original CRISPR CCTTCATTCCCTGAGATGGA TGG Intergenic
No off target data available for this crispr