ID: 953546299

View in Genome Browser
Species Human (GRCh38)
Location 3:43865981-43866003
Sequence GTGGTAAACAGGACTTAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953546296_953546299 -5 Left 953546296 3:43865963-43865985 CCATTTGGCTGCGACTAAGTGGT No data
Right 953546299 3:43865981-43866003 GTGGTAAACAGGACTTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953546299 Original CRISPR GTGGTAAACAGGACTTAGGC CGG Intergenic
No off target data available for this crispr