ID: 953549444

View in Genome Browser
Species Human (GRCh38)
Location 3:43890001-43890023
Sequence TTGGAGGAGCTGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953549444_953549448 -4 Left 953549444 3:43890001-43890023 CCTTCTTCCTTCAGCTCCTCCAA No data
Right 953549448 3:43890020-43890042 CCAATTACCCCAACTTTCAGAGG No data
953549444_953549450 3 Left 953549444 3:43890001-43890023 CCTTCTTCCTTCAGCTCCTCCAA No data
Right 953549450 3:43890027-43890049 CCCCAACTTTCAGAGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953549444 Original CRISPR TTGGAGGAGCTGAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr