ID: 953550081

View in Genome Browser
Species Human (GRCh38)
Location 3:43895020-43895042
Sequence TGCGGGTGGCTTTCCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953550081_953550084 -7 Left 953550081 3:43895020-43895042 CCTGGACAGGAAAGCCACCCGCA No data
Right 953550084 3:43895036-43895058 ACCCGCAGGCGCCTTCACCTTGG No data
953550081_953550088 9 Left 953550081 3:43895020-43895042 CCTGGACAGGAAAGCCACCCGCA No data
Right 953550088 3:43895052-43895074 ACCTTGGTCCACGTCTCACTCGG No data
953550081_953550091 23 Left 953550081 3:43895020-43895042 CCTGGACAGGAAAGCCACCCGCA No data
Right 953550091 3:43895066-43895088 CTCACTCGGATGATTCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953550081 Original CRISPR TGCGGGTGGCTTTCCTGTCC AGG (reversed) Intergenic