ID: 953550461

View in Genome Browser
Species Human (GRCh38)
Location 3:43898538-43898560
Sequence TGACCCTGAGTGAAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953550456_953550461 -9 Left 953550456 3:43898524-43898546 CCTCCAGCCAAGTCTGACCCTGA No data
Right 953550461 3:43898538-43898560 TGACCCTGAGTGAAAGAGGTGGG No data
953550455_953550461 18 Left 953550455 3:43898497-43898519 CCACATGAGGCTCAGAGATCTCT No data
Right 953550461 3:43898538-43898560 TGACCCTGAGTGAAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953550461 Original CRISPR TGACCCTGAGTGAAAGAGGT GGG Intergenic