ID: 953552168

View in Genome Browser
Species Human (GRCh38)
Location 3:43911839-43911861
Sequence GCTGATGGGGAACCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953552168_953552173 14 Left 953552168 3:43911839-43911861 CCAAAGCCTGGTTCCCCATCAGC No data
Right 953552173 3:43911876-43911898 CTCCCCACTAAGTTCTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953552168 Original CRISPR GCTGATGGGGAACCAGGCTT TGG (reversed) Intergenic
No off target data available for this crispr