ID: 953555996

View in Genome Browser
Species Human (GRCh38)
Location 3:43947517-43947539
Sequence TTCCACAGTGAAGAGTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953555996_953556004 19 Left 953555996 3:43947517-43947539 CCACATTACTCTTCACTGTGGAA No data
Right 953556004 3:43947559-43947581 GTCCTCCAGGAGTCTGGGCAAGG No data
953555996_953556000 -8 Left 953555996 3:43947517-43947539 CCACATTACTCTTCACTGTGGAA No data
Right 953556000 3:43947532-43947554 CTGTGGAAGGGGCAATATTAAGG No data
953555996_953556003 14 Left 953555996 3:43947517-43947539 CCACATTACTCTTCACTGTGGAA No data
Right 953556003 3:43947554-43947576 GCTGTGTCCTCCAGGAGTCTGGG No data
953555996_953556001 6 Left 953555996 3:43947517-43947539 CCACATTACTCTTCACTGTGGAA No data
Right 953556001 3:43947546-43947568 ATATTAAGGCTGTGTCCTCCAGG No data
953555996_953556002 13 Left 953555996 3:43947517-43947539 CCACATTACTCTTCACTGTGGAA No data
Right 953556002 3:43947553-43947575 GGCTGTGTCCTCCAGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953555996 Original CRISPR TTCCACAGTGAAGAGTAATG TGG (reversed) Intergenic
No off target data available for this crispr