ID: 953556637

View in Genome Browser
Species Human (GRCh38)
Location 3:43951366-43951388
Sequence CAGGCACAACTGAAGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953556633_953556637 8 Left 953556633 3:43951335-43951357 CCAGTGCCATGAGAGCTTGCTGT No data
Right 953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG No data
953556634_953556637 2 Left 953556634 3:43951341-43951363 CCATGAGAGCTTGCTGTGTCACA No data
Right 953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG No data
953556632_953556637 21 Left 953556632 3:43951322-43951344 CCTGAAACTTTCTCCAGTGCCAT No data
Right 953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG No data
953556631_953556637 30 Left 953556631 3:43951313-43951335 CCTTCTCTACCTGAAACTTTCTC No data
Right 953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953556637 Original CRISPR CAGGCACAACTGAAGTTTGG AGG Intergenic
No off target data available for this crispr