ID: 953557851

View in Genome Browser
Species Human (GRCh38)
Location 3:43960946-43960968
Sequence ACCAGCTCTCTGGCCAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953557851_953557856 11 Left 953557851 3:43960946-43960968 CCTTACTTGGCCAGAGAGCTGGT No data
Right 953557856 3:43960980-43961002 AATCCAGACTCTCTTCGGCCTGG No data
953557851_953557855 6 Left 953557851 3:43960946-43960968 CCTTACTTGGCCAGAGAGCTGGT No data
Right 953557855 3:43960975-43960997 AGAGGAATCCAGACTCTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953557851 Original CRISPR ACCAGCTCTCTGGCCAAGTA AGG (reversed) Intergenic
No off target data available for this crispr