ID: 953559236 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:43971887-43971909 |
| Sequence | CTGTGGGTGTCTCACTCTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953559236_953559242 | -8 | Left | 953559236 | 3:43971887-43971909 | CCCCCAGAGTGAGACACCCACAG | No data | ||
| Right | 953559242 | 3:43971902-43971924 | ACCCACAGTGTGGGTGACACAGG | No data | ||||
| 953559236_953559244 | -7 | Left | 953559236 | 3:43971887-43971909 | CCCCCAGAGTGAGACACCCACAG | No data | ||
| Right | 953559244 | 3:43971903-43971925 | CCCACAGTGTGGGTGACACAGGG | No data | ||||
| 953559236_953559246 | 2 | Left | 953559236 | 3:43971887-43971909 | CCCCCAGAGTGAGACACCCACAG | No data | ||
| Right | 953559246 | 3:43971912-43971934 | TGGGTGACACAGGGTCCTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953559236 | Original CRISPR | CTGTGGGTGTCTCACTCTGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||