ID: 953559236

View in Genome Browser
Species Human (GRCh38)
Location 3:43971887-43971909
Sequence CTGTGGGTGTCTCACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953559236_953559242 -8 Left 953559236 3:43971887-43971909 CCCCCAGAGTGAGACACCCACAG No data
Right 953559242 3:43971902-43971924 ACCCACAGTGTGGGTGACACAGG No data
953559236_953559244 -7 Left 953559236 3:43971887-43971909 CCCCCAGAGTGAGACACCCACAG No data
Right 953559244 3:43971903-43971925 CCCACAGTGTGGGTGACACAGGG No data
953559236_953559246 2 Left 953559236 3:43971887-43971909 CCCCCAGAGTGAGACACCCACAG No data
Right 953559246 3:43971912-43971934 TGGGTGACACAGGGTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953559236 Original CRISPR CTGTGGGTGTCTCACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr