ID: 953560137

View in Genome Browser
Species Human (GRCh38)
Location 3:43982653-43982675
Sequence CTATAGTCAATATGGTCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953560137_953560139 13 Left 953560137 3:43982653-43982675 CCAATTGACCATATTGACTATAG No data
Right 953560139 3:43982689-43982711 CTATCAAATAGTAGTCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953560137 Original CRISPR CTATAGTCAATATGGTCAAT TGG (reversed) Intergenic
No off target data available for this crispr