ID: 953561554

View in Genome Browser
Species Human (GRCh38)
Location 3:43996740-43996762
Sequence GGGCGGTCCCGGAGCGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953561554_953561564 18 Left 953561554 3:43996740-43996762 CCGTGTGCGCTCCGGGACCGCCC No data
Right 953561564 3:43996781-43996803 CTTCCCATTACCAAGGCAGCCGG No data
953561554_953561562 11 Left 953561554 3:43996740-43996762 CCGTGTGCGCTCCGGGACCGCCC No data
Right 953561562 3:43996774-43996796 CCCACAGCTTCCCATTACCAAGG No data
953561554_953561566 21 Left 953561554 3:43996740-43996762 CCGTGTGCGCTCCGGGACCGCCC No data
Right 953561566 3:43996784-43996806 CCCATTACCAAGGCAGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953561554 Original CRISPR GGGCGGTCCCGGAGCGCACA CGG (reversed) Intergenic
No off target data available for this crispr