ID: 953563074 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:44010292-44010314 |
| Sequence | AAGACTCACTATAATTTATG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953563074_953563078 | 19 | Left | 953563074 | 3:44010292-44010314 | CCTCATAAATTATAGTGAGTCTT | No data | ||
| Right | 953563078 | 3:44010334-44010356 | GAAGCTTTCAGAGCCCGTTGAGG | No data | ||||
| 953563074_953563075 | -3 | Left | 953563074 | 3:44010292-44010314 | CCTCATAAATTATAGTGAGTCTT | No data | ||
| Right | 953563075 | 3:44010312-44010334 | CTTCCAACTTCAGATTGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953563074 | Original CRISPR | AAGACTCACTATAATTTATG AGG (reversed) | Intergenic | ||