ID: 953563076

View in Genome Browser
Species Human (GRCh38)
Location 3:44010315-44010337
Sequence CTTCCTGGTCAATCTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563076_953563082 21 Left 953563076 3:44010315-44010337 CCAACTTCAGATTGACCAGGAAG No data
Right 953563082 3:44010359-44010381 TACAAGAGTCCCCAGGTGAGTGG No data
953563076_953563078 -4 Left 953563076 3:44010315-44010337 CCAACTTCAGATTGACCAGGAAG No data
Right 953563078 3:44010334-44010356 GAAGCTTTCAGAGCCCGTTGAGG No data
953563076_953563081 14 Left 953563076 3:44010315-44010337 CCAACTTCAGATTGACCAGGAAG No data
Right 953563081 3:44010352-44010374 TGAGGAATACAAGAGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563076 Original CRISPR CTTCCTGGTCAATCTGAAGT TGG (reversed) Intergenic