ID: 953563078

View in Genome Browser
Species Human (GRCh38)
Location 3:44010334-44010356
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563076_953563078 -4 Left 953563076 3:44010315-44010337 CCAACTTCAGATTGACCAGGAAG No data
Right 953563078 3:44010334-44010356 GAAGCTTTCAGAGCCCGTTGAGG No data
953563074_953563078 19 Left 953563074 3:44010292-44010314 CCTCATAAATTATAGTGAGTCTT No data
Right 953563078 3:44010334-44010356 GAAGCTTTCAGAGCCCGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type