ID: 953563112

View in Genome Browser
Species Human (GRCh38)
Location 3:44010513-44010535
Sequence CCATGCTGCTTGACACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563100_953563112 20 Left 953563100 3:44010470-44010492 CCTTGCAGCTGTGACCATTCCCT No data
Right 953563112 3:44010513-44010535 CCATGCTGCTTGACACACACAGG No data
953563105_953563112 0 Left 953563105 3:44010490-44010512 CCTTTGTCCTGCCCAGGGTGACC No data
Right 953563112 3:44010513-44010535 CCATGCTGCTTGACACACACAGG No data
953563101_953563112 6 Left 953563101 3:44010484-44010506 CCATTCCCTTTGTCCTGCCCAGG No data
Right 953563112 3:44010513-44010535 CCATGCTGCTTGACACACACAGG No data
953563104_953563112 1 Left 953563104 3:44010489-44010511 CCCTTTGTCCTGCCCAGGGTGAC No data
Right 953563112 3:44010513-44010535 CCATGCTGCTTGACACACACAGG No data
953563106_953563112 -7 Left 953563106 3:44010497-44010519 CCTGCCCAGGGTGACCCCATGCT No data
Right 953563112 3:44010513-44010535 CCATGCTGCTTGACACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563112 Original CRISPR CCATGCTGCTTGACACACAC AGG Intergenic
No off target data available for this crispr