ID: 953563619

View in Genome Browser
Species Human (GRCh38)
Location 3:44013308-44013330
Sequence AGACAGAGGCAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563619_953563631 28 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563631 3:44013359-44013381 GCACACACTCCAGGCTGGCTGGG No data
953563619_953563630 27 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563630 3:44013358-44013380 CGCACACACTCCAGGCTGGCTGG No data
953563619_953563625 19 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563625 3:44013350-44013372 TGCCCCTACGCACACACTCCAGG No data
953563619_953563624 -4 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data
953563619_953563629 23 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563629 3:44013354-44013376 CCTACGCACACACTCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563619 Original CRISPR AGACAGAGGCAGAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr