ID: 953563624

View in Genome Browser
Species Human (GRCh38)
Location 3:44013327-44013349
Sequence GTCTGGGAACTTTCTTCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563616_953563624 19 Left 953563616 3:44013285-44013307 CCCAGCTGGGCTGCCTTCATCTG No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data
953563618_953563624 6 Left 953563618 3:44013298-44013320 CCTTCATCTGCCATCCTCATTCT No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data
953563617_953563624 18 Left 953563617 3:44013286-44013308 CCAGCTGGGCTGCCTTCATCTGC No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data
953563622_953563624 -8 Left 953563622 3:44013312-44013334 CCTCATTCTGCCTCTGTCTGGGA No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data
953563615_953563624 20 Left 953563615 3:44013284-44013306 CCCCAGCTGGGCTGCCTTCATCT No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data
953563619_953563624 -4 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563624 3:44013327-44013349 GTCTGGGAACTTTCTTCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563624 Original CRISPR GTCTGGGAACTTTCTTCGCT TGG Intergenic
No off target data available for this crispr