ID: 953563625

View in Genome Browser
Species Human (GRCh38)
Location 3:44013350-44013372
Sequence TGCCCCTACGCACACACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563618_953563625 29 Left 953563618 3:44013298-44013320 CCTTCATCTGCCATCCTCATTCT No data
Right 953563625 3:44013350-44013372 TGCCCCTACGCACACACTCCAGG No data
953563622_953563625 15 Left 953563622 3:44013312-44013334 CCTCATTCTGCCTCTGTCTGGGA No data
Right 953563625 3:44013350-44013372 TGCCCCTACGCACACACTCCAGG No data
953563623_953563625 5 Left 953563623 3:44013322-44013344 CCTCTGTCTGGGAACTTTCTTCG No data
Right 953563625 3:44013350-44013372 TGCCCCTACGCACACACTCCAGG No data
953563619_953563625 19 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563625 3:44013350-44013372 TGCCCCTACGCACACACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563625 Original CRISPR TGCCCCTACGCACACACTCC AGG Intergenic
No off target data available for this crispr