ID: 953563629 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:44013354-44013376 |
| Sequence | CCTACGCACACACTCCAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953563623_953563629 | 9 | Left | 953563623 | 3:44013322-44013344 | CCTCTGTCTGGGAACTTTCTTCG | No data | ||
| Right | 953563629 | 3:44013354-44013376 | CCTACGCACACACTCCAGGCTGG | No data | ||||
| 953563619_953563629 | 23 | Left | 953563619 | 3:44013308-44013330 | CCATCCTCATTCTGCCTCTGTCT | No data | ||
| Right | 953563629 | 3:44013354-44013376 | CCTACGCACACACTCCAGGCTGG | No data | ||||
| 953563622_953563629 | 19 | Left | 953563622 | 3:44013312-44013334 | CCTCATTCTGCCTCTGTCTGGGA | No data | ||
| Right | 953563629 | 3:44013354-44013376 | CCTACGCACACACTCCAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953563629 | Original CRISPR | CCTACGCACACACTCCAGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||