ID: 953563629

View in Genome Browser
Species Human (GRCh38)
Location 3:44013354-44013376
Sequence CCTACGCACACACTCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563623_953563629 9 Left 953563623 3:44013322-44013344 CCTCTGTCTGGGAACTTTCTTCG No data
Right 953563629 3:44013354-44013376 CCTACGCACACACTCCAGGCTGG No data
953563619_953563629 23 Left 953563619 3:44013308-44013330 CCATCCTCATTCTGCCTCTGTCT No data
Right 953563629 3:44013354-44013376 CCTACGCACACACTCCAGGCTGG No data
953563622_953563629 19 Left 953563622 3:44013312-44013334 CCTCATTCTGCCTCTGTCTGGGA No data
Right 953563629 3:44013354-44013376 CCTACGCACACACTCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563629 Original CRISPR CCTACGCACACACTCCAGGC TGG Intergenic
No off target data available for this crispr