ID: 953563970

View in Genome Browser
Species Human (GRCh38)
Location 3:44015313-44015335
Sequence TCTGGGTCTCCGAGGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953563970_953563977 7 Left 953563970 3:44015313-44015335 CCATGTTGCCTCGGAGACCCAGA No data
Right 953563977 3:44015343-44015365 CTGCCTCAGCCCAGGCTTCTGGG No data
953563970_953563981 30 Left 953563970 3:44015313-44015335 CCATGTTGCCTCGGAGACCCAGA No data
Right 953563981 3:44015366-44015388 TCCTTCTCACTGCCTCTTTCAGG No data
953563970_953563976 6 Left 953563970 3:44015313-44015335 CCATGTTGCCTCGGAGACCCAGA No data
Right 953563976 3:44015342-44015364 GCTGCCTCAGCCCAGGCTTCTGG No data
953563970_953563974 -1 Left 953563970 3:44015313-44015335 CCATGTTGCCTCGGAGACCCAGA No data
Right 953563974 3:44015335-44015357 ACTCCAAGCTGCCTCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953563970 Original CRISPR TCTGGGTCTCCGAGGCAACA TGG (reversed) Intergenic
No off target data available for this crispr