ID: 953564100

View in Genome Browser
Species Human (GRCh38)
Location 3:44016376-44016398
Sequence TGCCCACCTAAAATCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953564094_953564100 21 Left 953564094 3:44016332-44016354 CCTCTGTTTTATATAGGCAGAGA No data
Right 953564100 3:44016376-44016398 TGCCCACCTAAAATCAGAAAAGG No data
953564093_953564100 22 Left 953564093 3:44016331-44016353 CCCTCTGTTTTATATAGGCAGAG No data
Right 953564100 3:44016376-44016398 TGCCCACCTAAAATCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953564100 Original CRISPR TGCCCACCTAAAATCAGAAA AGG Intergenic
No off target data available for this crispr