ID: 953566007

View in Genome Browser
Species Human (GRCh38)
Location 3:44032655-44032677
Sequence TGACAAAGGCTGAACAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953566007_953566011 5 Left 953566007 3:44032655-44032677 CCTTGCCTGTTCAGCCTTTGTCA No data
Right 953566011 3:44032683-44032705 TTCCAGGTCTCAGCTTCCCATGG No data
953566007_953566014 7 Left 953566007 3:44032655-44032677 CCTTGCCTGTTCAGCCTTTGTCA No data
Right 953566014 3:44032685-44032707 CCAGGTCTCAGCTTCCCATGGGG No data
953566007_953566012 6 Left 953566007 3:44032655-44032677 CCTTGCCTGTTCAGCCTTTGTCA No data
Right 953566012 3:44032684-44032706 TCCAGGTCTCAGCTTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953566007 Original CRISPR TGACAAAGGCTGAACAGGCA AGG (reversed) Intergenic
No off target data available for this crispr